中文 | | | / 搜索

Tagmentase (Tn5 transposase) – loaded EARLY ACCESS

目录号

格式

价格

C01070012-10

10 µl

$120.00

其他格式

C01070012-30

30 μl

C01070012-200

200 μl

Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.

Using Diagenode’s Tagmentase (Tn5 transposase) - loaded you may need also:

Looking for unloaded Tagmentase? Please go to Tagmentase (Tn5 transposase) – unloaded

TESTIMONIAL
We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!
Julia Liz Touza, AstraZeneca Gothenburg, Sweden

Examples of results
Tagmentase (Tn5 transposase) – loaded can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq. Here below we are showing some examples of results.

Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase
ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) – loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).

Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase
ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) – loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.

Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase
ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) – loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).

Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase
Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) – loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).

Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase
Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Tagmentase (Tn5 transposase) – loaded (Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003), H3K27ac (Cat. No. C15410196), H3K36me3 (Cat. No. C15410192), H3K27me3 (Cat. No. C15410195) and rabbit IgG (Cat. No. C15410206) have been used.
Product information
Tagmentase (Tn5 transposase) - loaded

Protein Molecular weight: 53.3 kDa

Expressed: in Escherichia coli

Product description: Diagenode Tagmentase – loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.

Mosaic end_reverse: 5’ [PHO]CTGTCTCTTATACACATCT 3’

Mosaic end_Adapter A: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3’

Mosaic end_Adapter B: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3’

Underlined regions correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:

24 SI for tagmented libraries, Cat. No. C01011032

24 UDI fortagmented libraries - Set I, Cat. No. C0101134

24 UDI for tagmented libraries - Set II, Cat. No. C0101136

24 UDI for tagmented libraries - Set III, Cat. No. C0101137

Storage conditions: Store at -20°C. Guaranteed stable for 6 months from date of receipt when stored properly.

Storage buffer: Supplied in solution containing 50% v/v glycerol.

Properties & Usage: Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55°C. SDS, EDTA/EGTA or heating to 65°C will inactivate the enzyme.

Applications: Tagmentase (Tn5 transposase) – loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.

For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:

ATAC-seq kit, Cat. No. C01080002

ATAC-seq package for tissue, Cat. No. C01080006

ChIPmentation Kit for Histones, Cat. No. C01011009

µChIPmentation Kit for Histones, Cat. No. C01011011

TAG Kit for ChIPmentation, Cat. No. C01011030
文档
Datasheet Tagmentase loaded C01070012 DATASHEET
Download

出版物

How to properly cite this product in your work

Diagenode strongly recommends using this: Tagmentase (Tn5 transposase) – loaded EARLY ACCESS (Diagenode Cat# C01070012-10). Click here to copy to clipboard.

Using our products in your publication? Let us know!

HIRA protects telomeres against R-loop-induced instability in ALT cancer cells
Michelle Lee Lynskey et al.
Highlights HIRA establishes greater telomeric chromatin accessibility after ATRX-DAXX loss Deposition of new H3.3 by HIRA-UBN restricts telomeric ssDNA and TERRA R-loops Unresolved TERRA R-loops block new H3.3 deposition by HIRA-UBN CHK1 phosphorylation of H3.3 is critical to pr...

ARMC5 selectively degrades SCAP-free SREBF1 and is essential for fatty acid desaturation in adipocytes
Akifumi Uota et al.
SREBF1 plays the central role in lipid metabolism. It has been known that full-length SREBF1 that did not associate with SCAP (SCAP-free SREBF1) is actively degraded, but its molecular mechanism and its biological meaning remain unclear. ARMC5-CUL3 complex was recently identified as E3 ubiquitin ligase of full-lengt...

HNF1β bookmarking involves Topoisomerase 1 activation and DNA topology relaxation in mitotic chromatin
Alessia Bagattin et al.
Highlights HNF1β mitotic site binding is preserved with a specific methanol/formaldehyde ChIP BTBD2, an HNF1β partner, mediates mitosis-specific interaction with TOP1 HNF1β recruits TOP1 and induces DNA relaxation around bookmarked HNF1β sites An HNF1β m...

Nuclear lamin A/C phosphorylation by loss of androgen receptor leads to cancer-associated fibroblast activation
Ghosh S. et al.
Alterations in nuclear structure and function are hallmarks of cancer cells. Little is known about these changes in Cancer-Associated Fibroblasts (CAFs), crucial components of the tumor microenvironment. Loss of the androgen receptor (AR) in human dermal fibroblasts (HDFs), which triggers early steps of CAF act...

A critical role for HNF4α in polymicrobial sepsis-associated metabolic reprogramming and death
van Dender C. et al.
In sepsis, limited food intake and increased energy expenditure induce a starvation response, which is compromised by a quick decline in the expression of hepatic PPARα, a transcription factor essential in intracellular catabolism of free fatty acids. The mechanism upstream of this PPARα downregulation i...

High-throughput sequencing of insect specimens with sub-optimal DNA preservation using a practical, plate-based Illumina-compatible Tn5 transposase library preparation method
Cobb L. et all.
Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, whi...

On the identification of differentially-active transcription factors from ATAC-seq data
Gerbaldo F. et al.
ATAC-seq has emerged as a rich epigenome profiling technique, and is commonly used to identify Transcription Factors (TFs) underlying given phenomena. A number of methods can be used to identify differentially-active TFs through the accessibility of their DNA-binding motif, however little is known on the best approa...

Cellular reprogramming in vivo initiated by SOX4 pioneer factor activity
Katsuda T.
Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate “reprogramming” by opening new chromatin sites for expr...

The ncBAF complex regulates transcription in AML through H3K27ac sensing by BRD9
Klein D.C. et al.
The non-canonical BAF complex (ncBAF) subunit BRD9 is essential for acute myeloid leukemia (AML) cell viability but has an unclear role in leukemogenesis. Because BRD9 is required for ncBAF complex assembly through its DUF3512 domain, precise bromodomain inhibition is necessary to parse the role of BRD9 as a transcr...

ARID1A governs the silencing of sex-linked transcription during male meiosis in the mouse
Menon D.U. et al.
We present evidence implicating the BAF (BRG1/BRM Associated Factor) chromatin remodeler in meiotic sex chromosome inactivation (MSCI). By immunofluorescence (IF), the putative BAF DNA binding subunit, ARID1A (AT-rich Interaction Domain 1a), appeared enriched on the male sex chromosomes during diplonema of meiosis I...

Zfp296 knockout enhances chromatin accessibility and induces a uniquestate of pluripotency in embryonic stem cells.
Miyazaki S. et al.
The Zfp296 gene encodes a zinc finger-type protein. Its expression is high in mouse embryonic stem cells (ESCs) but rapidly decreases following differentiation. Zfp296-knockout (KO) ESCs grew as flat colonies, which were reverted to rounded colonies by exogenous expression of Zfp296. KO ESCs could not form teratomas...

YAP/BRD4-controlled ROR1 promotes tumor-initiating cells andhyperproliferation in pancreatic cancer.
Yamazaki M. et al.
Tumor-initiating cells are major drivers of chemoresistance and attractive targets for cancer therapy, however, their identity in human pancreatic ductal adenocarcinoma (PDAC) and the key molecules underlying their traits remain poorly understood. Here, we show that a cellular subpopulation with partial epithelial-m...

Analyzing genomic and epigenetic profiles in single cells by hybridtransposase (scGET-seq).
Cittaro D. et al.
scGET-seq simultaneously profiles euchromatin and heterochromatin. scGET-seq exploits the concurrent action of transposase Tn5 and its hybrid form TnH, which targets H3K9me3 domains. Here we present a step-by-step protocol to profile single cells by scGET-seq using a 10Ã— Chromium Controller. We describ...

A neurodevelopmental epigenetic programme mediated bySMARCD3-DAB1-Reelin signalling is hijacked to promote medulloblastomametastasis.
Zou Han et al.
How abnormal neurodevelopment relates to the tumour aggressiveness of medulloblastoma (MB), the most common type of embryonal tumour, remains elusive. Here we uncover a neurodevelopmental epigenomic programme that is hijacked to induce MB metastatic dissemination. Unsupervised analyses of integrated publicly availab...

Physiological reprogramming in vivo mediated by Sox4 pioneer factoractivity
Katsuda T. et al.
Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate “reprogramming” by opening new chromatin sites for expr...

EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.
Zolotarev Nikolay et al.
The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to naïve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whet...

相关产品
- C01019043
  
  Tagmentation Buffer (2x)
- C01011034
  
  24 UDI for Tagmented libraries - Set I
- C01080002
  
  ATAC-seq kit
- C01080006
  
  ATAC-seq package for tissue
- C01070010-10
  
  Tagmentase

Notice (8): Undefined variable: solution_of_interest [APP/View/Products/view.ctp, line 755]Code Context<!-- BEGIN: REQUEST_FORM MODAL -->
<div id="request_formModal" class="reveal-modal medium" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
    <?= $this->element('Forms/simple_form', array('solution_of_interest' => $solution_of_interest, 'header' => $header, 'message' => $message, 'campaign_id' => $campaign_id)) ?>
$viewFile = '/home/website-server/www/app/View/Products/view.ctp'
$dataForView = array(
	'language' => 'cn',
	'meta_keywords' => '',
	'meta_description' => '',
	'meta_title' => 'Tagmentase - loaded - 10',
	'product' => array(
		'Product' => array(
			'id' => '3165',
			'antibody_id' => null,
			'name' => 'Tagmentase (Tn5 transposase) – loaded EARLY ACCESS',
			'description' => '',
			'label1' => '',
			'info1' => '',
			'label2' => '',
			'info2' => '',
			'label3' => '',
			'info3' => '',
			'format' => '10 µl',
			'catalog_number' => 'C01070012-10',
			'old_catalog_number' => '',
			'sf_code' => 'C01070012-19650',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '120',
			'price_USD' => '120',
			'price_GBP' => '115',
			'price_JPY' => '18800',
			'price_CNY' => '',
			'price_AUD' => '300',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => false,
			'last_datasheet_update' => '',
			'slug' => 'tagmentase-loaded-10',
			'meta_title' => 'Tagmentase - loaded - 10',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2024-09-13 14:26:44',
			'created' => '2020-12-08 16:17:54',
			'locale' => 'zho'
		),
		'Antibody' => array(
			'host' => '*****',
			'id' => null,
			'name' => null,
			'description' => null,
			'clonality' => null,
			'isotype' => null,
			'lot' => null,
			'concentration' => null,
			'reactivity' => null,
			'type' => null,
			'purity' => null,
			'classification' => null,
			'application_table' => null,
			'storage_conditions' => null,
			'storage_buffer' => null,
			'precautions' => null,
			'uniprot_acc' => null,
			'slug' => null,
			'meta_keywords' => null,
			'meta_description' => null,
			'modified' => null,
			'created' => null,
			'select_label' => null
		),
		'Slave' => array(),
		'Group' => array(
			'Group' => array(
				[maximum depth reached]
			),
			'Master' => array(
				[maximum depth reached]
			),
			'Product' => array(
				[maximum depth reached]
			)
		),
		'Related' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			),
			(int) 2 => array(
				[maximum depth reached]
			),
			(int) 3 => array(
				[maximum depth reached]
			),
			(int) 4 => array(
				[maximum depth reached]
			)
		),
		'Application' => array(),
		'Category' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Document' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Feature' => array(),
		'Image' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Promotion' => array(),
		'Protocol' => array(),
		'Publication' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			),
			(int) 2 => array(
				[maximum depth reached]
			),
			(int) 3 => array(
				[maximum depth reached]
			),
			(int) 4 => array(
				[maximum depth reached]
			),
			(int) 5 => array(
				[maximum depth reached]
			),
			(int) 6 => array(
				[maximum depth reached]
			),
			(int) 7 => array(
				[maximum depth reached]
			),
			(int) 8 => array(
				[maximum depth reached]
			),
			(int) 9 => array(
				[maximum depth reached]
			),
			(int) 10 => array(
				[maximum depth reached]
			),
			(int) 11 => array(
				[maximum depth reached]
			),
			(int) 12 => array(
				[maximum depth reached]
			),
			(int) 13 => array(
				[maximum depth reached]
			),
			(int) 14 => array(
				[maximum depth reached]
			),
			(int) 15 => array(
				[maximum depth reached]
			)
		),
		'Testimonial' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Area' => array(),
		'SafetySheet' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			),
			(int) 2 => array(
				[maximum depth reached]
			),
			(int) 3 => array(
				[maximum depth reached]
			),
			(int) 4 => array(
				[maximum depth reached]
			),
			(int) 5 => array(
				[maximum depth reached]
			),
			(int) 6 => array(
				[maximum depth reached]
			),
			(int) 7 => array(
				[maximum depth reached]
			)
		)
	),
	'meta_canonical' => 'https://www.diagenode.com/cn/p/tagmentase-loaded-30'
)
$language = 'cn'
$meta_keywords = ''
$meta_description = ''
$meta_title = 'Tagmentase - loaded - 10'
$product = array(
	'Product' => array(
		'id' => '3165',
		'antibody_id' => null,
		'name' => 'Tagmentase (Tn5 transposase) – loaded EARLY ACCESS',
		'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns">
<p>&nbsp;</p>
<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
		'label1' => 'Examples of results',
		'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label2' => 'Product information',
		'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span> 3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span> correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions: </strong>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong> Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong> Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div>ATAC-seq package for tissue, Cat. No.&nbsp;<span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label3' => '',
		'info3' => '',
		'format' => '10 µl',
		'catalog_number' => 'C01070012-10',
		'old_catalog_number' => '',
		'sf_code' => 'C01070012-19650',
		'type' => 'FRE',
		'search_order' => '',
		'price_EUR' => '120',
		'price_USD' => '120',
		'price_GBP' => '115',
		'price_JPY' => '18800',
		'price_CNY' => '',
		'price_AUD' => '300',
		'country' => 'ALL',
		'except_countries' => 'None',
		'quote' => false,
		'in_stock' => false,
		'featured' => false,
		'no_promo' => false,
		'online' => true,
		'master' => false,
		'last_datasheet_update' => '',
		'slug' => 'tagmentase-loaded-10',
		'meta_title' => 'Tagmentase - loaded - 10',
		'meta_keywords' => '',
		'meta_description' => '',
		'modified' => '2024-09-13 14:26:44',
		'created' => '2020-12-08 16:17:54',
		'locale' => 'zho'
	),
	'Antibody' => array(
		'host' => '*****',
		'id' => null,
		'name' => null,
		'description' => null,
		'clonality' => null,
		'isotype' => null,
		'lot' => null,
		'concentration' => null,
		'reactivity' => null,
		'type' => null,
		'purity' => null,
		'classification' => null,
		'application_table' => null,
		'storage_conditions' => null,
		'storage_buffer' => null,
		'precautions' => null,
		'uniprot_acc' => null,
		'slug' => null,
		'meta_keywords' => null,
		'meta_description' => null,
		'modified' => null,
		'created' => null,
		'select_label' => null
	),
	'Slave' => array(),
	'Group' => array(
		'Group' => array(
			'id' => '331',
			'name' => 'C01070012',
			'product_id' => '3164',
			'modified' => '2020-12-08 16:19:24',
			'created' => '2020-12-08 16:19:24'
		),
		'Master' => array(
			'id' => '3164',
			'antibody_id' => null,
			'name' => 'Tagmentase (Tn5 transposase) - loaded',
			'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns">
<p>&nbsp;</p>
<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
			'label1' => 'Examples of results',
			'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => 'Product information',
			'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span> 3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span> correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions: </strong>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong> Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong> Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div>ATAC-seq package for tissue, Cat. No.&nbsp;<span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '30 μl',
			'catalog_number' => 'C01070012-30',
			'old_catalog_number' => '',
			'sf_code' => 'C01070012-143301',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '330',
			'price_USD' => '330',
			'price_GBP' => '300',
			'price_JPY' => '51695',
			'price_CNY' => '',
			'price_AUD' => '825',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => true,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'tagmentase-loaded-30',
			'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 30 | Diagenode',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
			'modified' => '2024-09-13 15:36:59',
			'created' => '2020-12-08 16:15:40'
		),
		'Product' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			)
		)
	),
	'Related' => array(
		(int) 0 => array(
			'id' => '3162',
			'antibody_id' => null,
			'name' => 'Tagmentation Buffer (2x)',
			'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode <strong>Tagmentation Buffer (2x)</strong> is the recommended reagent to perform any tagmentation reactions. It can be used in combination with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase)</a> on DNA or chromatin samples, as half of the total volume reaction like in ATAC-seq protocol.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
 var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); } 
// ]]></script>
</center></div>
</div>
<p></p>',
			'label1' => 'Examples of use',
			'info1' => '<p><span style="text-decoration: underline;">ATAC-seq experiments: </span></p>
<ul style="list-style-type: circle;">
<li>After cell lysis and nuclei isolation, the nuclei pellets can be incubated with the following mix for 1 reaction:</li>
</ul>
<table style="width: 447px;">
<tbody>
<tr>
<td style="width: 326px;">Tagmentation Buffer (2x)</td>
<td style="width: 114px; padding-left: 30px;">25 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Tagmentase loaded</td>
<td style="width: 114px; padding-left: 30px;">2.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;"><span>Digitonin 1%</span></td>
<td style="width: 114px; padding-left: 30px;">0.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Tween20 10%</td>
<td style="width: 114px; padding-left: 30px;">0.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">PBS</td>
<td style="width: 114px; padding-left: 30px;">16.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Nuclease-free water</td>
<td style="width: 114px; padding-left: 30px;">&nbsp;5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Nuclei pellet*</td>
<td style="width: 114px;"></td>
</tr>
</tbody>
</table>
<p><em>*&nbsp; The number of nuclei per reaction will depend on the ATAC-seq experimental design. Successful tagmentation with the proposed protocol has been performed on 50,000 nuclei per reaction.&nbsp;</em></p>
<ul style="list-style-type: circle;">
<li>The reaction is then incubated 30 minutes at 37&deg;C.</li>
<li>The tagmentation reaction can then be stopped by addition of 250 &micro;l of DNA Binding buffer from Diagenode MicroChIP DiaPure Columns (Cat. No. C03040001).</li>
<li>The tagmented libraries can then be purified using the MicroChIP DiaPure Columns (Cat. No. C03040001), and amplified.</li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => '',
			'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '300 µl ',
			'catalog_number' => 'C01019043',
			'old_catalog_number' => '',
			'sf_code' => 'C01019043-29421',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '90',
			'price_USD' => '100',
			'price_GBP' => '105',
			'price_JPY' => '14100',
			'price_CNY' => '',
			'price_AUD' => '250',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'tagmentation-buffer-2x',
			'meta_title' => 'Tagmentation Buffer 2x',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2023-06-20 18:19:03',
			'created' => '2020-12-08 16:00:14',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		),
		(int) 1 => array(
			'id' => '3158',
			'antibody_id' => null,
			'name' => '24 UDI for Tagmented libraries - Set I',
			'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries</strong> includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">&mu;ChIPmentation for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&amp;Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><strong>24 UDI for tagmented libraries - Set I</strong><br /> <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries -&nbsp; Set III</a><br /><br /></p>
<p><span>Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</span></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples&nbsp;</b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label1' => 'Characteristics',
			'info1' => '<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries &ndash; Set I </b>is compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&amp;Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of &micro;ChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the &micro;ChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries &ndash; Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => '',
			'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '24 UDI',
			'catalog_number' => 'C01011034',
			'old_catalog_number' => '',
			'sf_code' => 'C01011034-',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '165',
			'price_USD' => '185',
			'price_GBP' => '155',
			'price_JPY' => '25845',
			'price_CNY' => '',
			'price_AUD' => '462',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set1',
			'meta_title' => '24 unique dual indexes for tagmented libraries set 1',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2024-05-15 10:25:12',
			'created' => '2020-12-08 15:26:23',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		),
		(int) 2 => array(
			'id' => '3194',
			'antibody_id' => null,
			'name' => 'ATAC-seq kit',
			'description' => '<p><a href="https://www.diagenode.com/files/products/kits/atacseq-kit-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p><strong>ATAC-seq</strong>, Assay for<span>&nbsp;</span><strong>T</strong>ransposase-<strong>A</strong>ccessible<span>&nbsp;</span><strong>C</strong>hromatin, followed by next generation sequencing, is a key technology for genome-wide mapping of accessible chromatin. The technology is based on the use of the<span>&nbsp;</span><strong>transposase Tn5</strong><span>&nbsp;</span>which cuts exposed open chromatin and simultaneously ligates adapters for subsequent amplification and sequencing. ATAC-seq methods allow you to:</p>
<ul>
<li>&nbsp;Gain insight into gene regulation and understand open chromatin signatures</li>
<li>&nbsp;Determine nucleosome positions at single nucleotide resolution</li>
<li>&nbsp;Uncover transcription factor (TF) occupancy</li>
</ul>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Diagenode&rsquo;s<span>&nbsp;</span><b>ATAC-</b><b>seq</b><b><span>&nbsp;</span>kit<span>&nbsp;</span></b>is based on a highly validated protocol optimized for<span>&nbsp;</span><b>50,000<span>&nbsp;</span></b><b>cells</b><b><span>&nbsp;</span>per<span>&nbsp;</span></b><b>reaction</b>. The kit includes the reagents for cell lysis and nuclei extraction, tagmentation and DNA purification as well as for library amplification. The <a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">primer indexes for multiplexing</a> are not included in the kit and must be purchased separately.</p>
<h4><span style="font-weight: 400;">ATAC-seq kit features:</span></h4>
<ul>
<li><b>Cell<span>&nbsp;</span></b><b>requirement</b><b>:<span>&nbsp;</span></b><b>50,000<span>&nbsp;</span></b><b>cells /<span>&nbsp;</span></b><b>rxn</b></li>
<li><b>Robust protocol<span>&nbsp;</span></b>with<span>&nbsp;</span><b>high reproducibility<span>&nbsp;</span></b>between replicates and repetitive experiments</li>
<li><strong>Easy</strong><span>&nbsp;</span>and<span>&nbsp;</span><b>efficient DNA capture<span>&nbsp;</span></b>after the tagmentation reaction using Diagenode`s MicroChIP DiaPure columns (included)</li>
<li>Additional qPCR step to determine the number of cycles needed for library amplification: &nbsp;</li>
<ul type="&rdquo;square&rdquo;">
<li><b>Avoids<span>&nbsp;</span></b><b>over-amplification</b></li>
<li>Allows adaptation/flexibility for<span>&nbsp;</span><b>more challenging samples<span>&nbsp;</span></b>to succeed with library prep.</li>
<li>Gives<span>&nbsp;</span><strong>early indication</strong><span>&nbsp;</span>if the experiment does not work (no qPCR amplification)</li>
</ul>
</ul>
<p>Looking for ATAC-seq on tissue? Please, go to: <a href="https://www.diagenode.com/en/p/ATAC-seq-package-tissue-C01080006">ATAC-seq package for tissue</a></p>',
			'label1' => 'Method overview',
			'info1' => '<p><strong>ATAC-seq</strong>, <strong>A</strong>ssay for <strong>T</strong>ransposase-<strong>A</strong>ccessible <strong>C</strong>hromatin, followed by next generation sequencing, is a key technology to easily identify the <strong>open regions of the chromatin.</strong> The protocol consists of <strong>3 steps</strong>: <strong>nuclei preparation</strong>, <strong>tagmentation</strong> and <strong>library amplification</strong>. First, the cells undergo the lysis, ending with the crude nuclei. Then, the nuclei are incubated with a tagmentase (Tn5 transposase), which &nbsp;cuts the genomic regions associated with open chromatin and inserts the sequencing adaptors. Finally, the generated libraries are amplified and can be used for sequencing. High-throughput sequencing will then detect peaks, in open regions of the chromatin only, giving a map of the chromatin status in the whole genome of the sample.</p>
<p><img src="https://www.diagenode.com/img/product/kits/workflow-atac-seq.png" alt="ATAC-seq kit workflow" width="600px" caption="false" /></p>',
			'label2' => 'Example of results',
			'info2' => '<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig1.png" alt="library prepared with the Diagenode ATAC-seq kit " width="500px" caption="false" /></p>
<p><strong>Figure 1.</strong>Representative Bioanalyzer profile of an ATAC-seq library prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells.</p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig2.png" alt="Diagenode ATAC-seq kit " caption="false" width="951" height="148" /></p>
<p><strong>Figure 2.</strong> Main ATAC-seq alignment and peak calling statistics of 3 replicates prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells. (Mapping efficiency: Percentage of non-mitochondrial reads that mapped to the reference genome. Uniquely mapped ratio: Proportion of mapped reads that map to only one location on the reference genome (hg19). Peaks: Number of peaks (open chromatin regions) identified by MACS2 for each sample. FRiP - Fraction of reads in peaks: Percentage of reads in peaks, with respect to the number of uniquely mapped reads. Sequencing was realized in paired-end mode 50 base pairs (PE50) on an Illumina NovaSeq6000.)</p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig3a.png" alt="Assay for Transposase-Accessible Chromatin" width="500px" caption="false" /></p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig3b.png" alt="Assay for Transposase-Accessible Chromatin" width="500px" caption="false" /></p>
<p><strong>Figure 3</strong> Sequencing profiles of ATAC-seq library (3 replicates) prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells.</p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig4.png" alt=" open chromatin regions" caption="false" width="383" height="739" /></p>
<p><strong>Figure 4. </strong><br /> Heatmap around TSS of three ATAC-seq replicates prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells.</p>',
			'label3' => 'Additional solutions for ATAC-seq kit',
			'info3' => '<p><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes for tagmented libraries</a></p>
<p>Magnetic rack:<span>&nbsp;</span><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag</a><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit"><span>&nbsp;</span>0.2 ml &ndash; Cat. No. B04000001</a></p>
<p>Additional supplies (included in the kit and available separately):</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30"><span>&nbsp;</span>(Tn5 transposase)<span>&nbsp;</span></a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">loaded</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">, Cat. No. C01070012</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation</a><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x"><span>&nbsp;</span>Buffer (2x), Cat. No. C01019043</a></li>
<li><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">MicroChIP</a><span>&nbsp;</span><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">DiaPure</a><span>&nbsp;</span><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">columns</a><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">, Cat. No. C03040001</a></li>
</ul>',
			'format' => '24 rxns',
			'catalog_number' => 'C01080002',
			'old_catalog_number' => '',
			'sf_code' => 'C01080002-',
			'type' => 'RFR',
			'search_order' => '',
			'price_EUR' => '1740',
			'price_USD' => '1745',
			'price_GBP' => '1485',
			'price_JPY' => '272570',
			'price_CNY' => '',
			'price_AUD' => '4362',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'atac-seq-kit-24rxns',
			'meta_title' => 'ATAC-seq kit for open chromatin assessment C01080001 | Diagenode ',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode’s ATAC-seq kit provides a robust protocol for assessing genome-wide chromatin accessibility',
			'modified' => '2024-10-21 10:11:12',
			'created' => '2021-07-01 15:46:58',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		),
		(int) 3 => array(
			'id' => '3215',
			'antibody_id' => null,
			'name' => 'ATAC-seq package for tissue',
			'description' => '<p><a href="https://www.diagenode.com/files/products/kits/atacseq-kit-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p><b>ATAC-seq</b>, Assay for&nbsp;<b>T</b>ransposase-<b>A</b>ccessible&nbsp;<b>C</b>hromatin, followed by next generation sequencing, is a key technology for genome-wide mapping of accessible chromatin. The technology is based on the use of the&nbsp;<b>transposase Tn5</b>&nbsp;which cuts exposed open chromatin and simultaneously ligates adapters for subsequent amplification and sequencing.</p>
<p>The Diagenode&rsquo;s <b>ATAC-</b><b>seq</b><b> package for tissue </b>has been specifically developted and optimized to generate the ATAC-seq libraries from tissue samples on <b>25 to 100 mg of tissue per </b><b>reaction</b>. The protocol has been validated on many different mammalian tissues (lung, liver, brain, kidney, muscles) and different species (pork, chicken, rat, mice, horse). The package includes the reagents for complete ATAC-seq workflow, including nuclei extraction, library preparation and multiplexing.</p>
<p><strong>Content of the ATAC-seq package for tissues:</strong></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004" target="_blank" title="Tissue Nuclei Extraction for ATAC-seq">Tissue<span>&nbsp;</span>Nuclei<span>&nbsp;</span>Extraction for ATAC-seq</a><span>&nbsp;</span>&ndash; optimized protocol and reagents for highly efficient nuclei isolation from tissue, preserving the nuclei</li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq<span>&nbsp;</span>kit</a><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns"><span>&nbsp;</span></a>&ndash; generation of high quality libraries</li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24&nbsp;UDI for<span>&nbsp;</span>tagmented<span>&nbsp;</span>libraries*</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries"><span>&nbsp;</span></a>&ndash; efficient multiplexing allowing for index hopping identification and filtering.&nbsp;</li>
</ul>
<p><strong>Features:</strong></p>
<ul>
<li>Complete solution for the ATAC-seq workflow</li>
<li>Highly efficient nuclei extraction from tissue</li>
<li>Validated on many mammalian tissues</li>
<li>Compatible with Illumina sequencing platforms</li>
</ul>
<p>Looking for ATAC-seq for cells? Please go to<span>&nbsp;</span><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns">ATAC-seq kit</a>.</p>
<p><em>* For libraries multiplexing, the ATAC-seq package 24 rxns includes&nbsp; the 24 UDI for tagmented libraries kit - set I, Cat. No. C01011034. If needed, higher multiplexing is possible using other sets of <a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries" target="_blank" title="Primer indexes for tagmented libraries">Primer indexes for tagmented libraries</a>, available separately.</em></p>
<p></p>
<p><small><img src="https://icons.iconarchive.com/icons/wikipedia/flags/256/EU-European-Union-Flag-icon.png" alt="" width="45" />&nbsp; The project GENE-SWitCH leading to this application has received funding from the European Union&rsquo;s Horizon 2020 research and innovation programme under the grant agreement No 817998.<small></small></small></p>',
			'label1' => 'Method overview',
			'info1' => '<p><b>ATAC-seq</b>, <b>A</b>ssay for <b>T</b>ransposase-<b>A</b>ccessible <b>C</b>hromatin, followed by next generation sequencing, is a key technology to easily identify the <b>open regions of the chromatin.</b> The protocol consists of <b>3 steps</b>: <b>nuclei preparation</b>, <b>tagmentation</b> and <b>library amplification</b>. First, the tissue undergoes lysis, ending with the crude nuclei. Then, the nuclei are incubated with a tagmentase (Tn5 transposase), which cuts the genomic regions associated with open chromatin and inserts the sequencing adaptors. Finally, the generated libraries are amplified and can be used for sequencing. High-throughput sequencing will then detect peaks, in open regions of the chromatin only, giving a map of the chromatin status in the whole genome of the sample.</p>
<p><br /> <img src="https://www.diagenode.com/img/product/kits/workflow-atac-seq-tissue.png" alt="workflow" style="display: block; margin-left: auto; margin-right: auto;" width="600px" /></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => 'Example of results',
			'info2' => '<p>GENE-SWitCH aims to deliver new underpinning knowledge on the functional genomes of two main monogastric farm species (pig and chicken) and to enable immediate translation to the pig and poultry sectors. It is a multi-actor project that will produce new genome information to enable the characterization of genetic and epigenetic determinants of complex traits in these two species. Diagenode, as a principal participant to the project and leading the WP1, developed a new protocol to improve the preparation of ATAC-seq libraries from a variety of snap-frozen tissues. The ATAC-seq protocol combines efficient nuclei extraction procedure validated on 7 different kinds of tissues from 3 developmental stages of the two species and a robust Tagmentation protocol based on Diagenode Tn5 enzyme. The developed ATAC-seq protocol was successfully used to produce 168 ATAC-seq libraries for WP1 and 320 for WP5.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/table1-atacseq-results.png" width="400" /></center>
<p><small><strong>Table 1.</strong> List of validated tissues with Diagenode&rsquo;s ATAC-seq package for tissue (Cat. No. C01080005/6). The samples were used as part of GENE-SWitCH consortium.</small></p>
<p>A.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2a-atacseq-results.png" width="700" /></center>
<p>B.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2b-atacseq-results.png" width="700" /></center>
<p><small><strong>Figure 2.</strong> ATAC-seq library profiles generated using the ATAC-seq package for tissue (Cat. No. C01080005/6) from pork&rsquo;s liver (A) and brain (B). The samples were used as part of GENE-SWitCH consortium.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => 'Additional solutions for ATAC-seq for tissue',
			'info3' => '<p>Additional supplies (included in the kit and available separately):</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">&nbsp;(Tn5 transposase)&nbsp;loaded, Cat. No. C01070012</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation</a><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">&nbsp;Buffer (2x), Cat. No. C01019043</a></li>
<li><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">MicroChIP</a>&nbsp;<a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">DiaPure</a>&nbsp;<a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">columns, Cat. No. C03040001</a></li>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004">Tissue Nuclei Extraction for ATAC-seq, Cat. No. C0108004</a></li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq kit, Cat. No. C01080002</a></li>
</ul>
<p>Other supplies:</p>
<ul>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes for tagmented libraries</a></li>
<li><a href="https://www.diagenode.com/en/p/protease-inhibitor-mix-100-ul">Protease Inhibitor Mix 200X</a></li>
<li>Magnetic rack:&nbsp;<a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag</a><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">&nbsp;0.2 ml &ndash; Cat. No. B04000001</a></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '24 rxns',
			'catalog_number' => 'C01080006',
			'old_catalog_number' => '',
			'sf_code' => 'C01080006-',
			'type' => 'RFR',
			'search_order' => '',
			'price_EUR' => '2050',
			'price_USD' => '2050',
			'price_GBP' => '1765',
			'price_JPY' => '321130',
			'price_CNY' => '',
			'price_AUD' => '5125',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'ATAC-seq-package-tissue-C01080006',
			'meta_title' => 'ATAC-seq package for tissue|Diagenode C01080006',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode’s ATAC-seq package for tissue provides a robust protocol for assessing genome-wide chromatin accessibility on tissue samples. ',
			'modified' => '2023-04-06 11:06:44',
			'created' => '2022-03-23 16:37:31',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array([maximum depth reached])
		),
		(int) 4 => array(
			'id' => '3057',
			'antibody_id' => null,
			'name' => 'Tagmentase (Tn5 transposase) - unloaded',
			'description' => '<div class="extra-spaced"><center><img alt="Tagmentase (Tn5 transposase)" src="https://www.diagenode.com/img/banners/banner-tagmentase.jpg" caption="false" width="787" height="236" /></center></div>
<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode Tagmentase is a hyperactive Tn5 transposase with the potential to enhance epigenetic studies. Its ability to cut DNA and insert sequences of interest in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq, ChIPmentation, CHANGE-seq and other. The enzyme is not loaded with DNA oligos, providing flexibility of application. To ensure optimal results the concentration may be adjusted with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> (Cat. No. C01070011), available separately.</p>
<p><a href="https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf" target="_blank">Protocol for transposome assembly</a></p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) you may also need:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for loaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) - loaded</a>.</p>',
			'label1' => 'Quality control',
			'info1' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><img alt="Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1a.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="653" height="282" /></p>
<p><img alt="Tagmentase Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1b.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="645" height="278" /></p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 1: Efficient fragmentation of the lambda DNA after incubation with the Tagmentase</strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with diluted Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). Profiles show the size of lambda DNA before (A) and after treatment with Tagmentase (B).</p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns"><center><img alt="Tn5 transposase perfect for NGS" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure2.jpg" width="754" height="492" /></center></div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 2: Fragmentation efficiency depending on the amount of Tagmentase </strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The Tagmentase was previously diluted with the Tagmentase Dilution Buffer (Cat. No.) at &frac14; and 1/16 dilutions. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). The migration of the samples shows variations of the size distribution according to the amount of Tagmentase used for the reaction.</p>
</div>
</div>',
			'label2' => 'Product information',
			'info2' => '<p><strong>Tagmentase (Tn5 transposase) - unloaded</strong></p>
<div><span style="font-family: inherit;">Protein Molecular weight: 53.3 kDa</span></div>
<p>Expressed: in Escherichia coli</p>
<p><strong>Product description:</strong> Diagenode Tagmentase &ndash; unloaded is a hyperactive Tn5 transposase. The enzyme catalyzes &ldquo;cut and paste&rdquo; tagmentation reaction and can be used to insert any target DNA in vitro.</p>
<p><strong>Storage conditions:</strong> Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer: </strong>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>The enzyme should be loaded with appropriate oligonucleotides prior to use. An efficient transposition require that insert DNA have a specific 19-bp transposase recognition sequence (Mosaic End or ME sequence) at each of its ends. The transposome assembly protocol can be found at https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications: </strong>Tagmentase (Tn5 transposase) &ndash; unloaded can be used in a variety of applications including transgenic experiments, barcoding and library construction for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '10 µl',
			'catalog_number' => 'C01070010-10',
			'old_catalog_number' => '',
			'sf_code' => 'C01070010-19650',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '355',
			'price_USD' => '355',
			'price_GBP' => '320',
			'price_JPY' => '55610',
			'price_CNY' => '0',
			'price_AUD' => '888',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'tagmentase',
			'meta_title' => 'Tagmentase (Tn5 transposase) -unloaded | Diagenode',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. The enzyme is not loaded with DNA oligos, providing flexibility of application.',
			'modified' => '2024-09-13 15:48:15',
			'created' => '2020-03-24 17:33:04',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		)
	),
	'Application' => array(),
	'Category' => array(
		(int) 0 => array(
			'id' => '3',
			'position' => '4',
			'parent_id' => null,
			'name' => 'Kits',
			'description' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p style="text-align: justify;">Diagenode&rsquo;s epigenetic reagents include:</p>
<ul>
<li style="text-align: justify;"><strong>DNA methylation kits and antibodies</strong> - Validated&nbsp;NGS-compatible kits for MeDIP, MBD pull-down, whole genome bisulfite sequencing, and reduced representation bisulfite sequencing. Official provider for the original clone for 5-mC 33D3.</li>
<li style="text-align: justify;"><strong>ChIP and ChIP-seq kits for industry-leading specificity and sensitivity</strong> - MicroChIP/MicroPlex Kit for ChIP-seq with only 10,000 cells and the iDeal ChIP-seq Kits optimized for both transcription factors and histones. Our kits feature full reagents for ChIP-seq including control primers, control antibodies, magnetics beads, and purification reagents.</li>
<li style="text-align: justify;"><strong>Library preparation kits</strong> tailored for your specific requirements. The MicroPlex Library Preparation Kit simplifies library preparation requiring only 3 simple steps and allowing inputs of only 50 pg.&nbsp;</li>
</ul>
</div>
</div>',
			'no_promo' => false,
			'in_menu' => false,
			'online' => true,
			'tabular' => false,
			'hide' => false,
			'all_format' => false,
			'is_antibody' => false,
			'slug' => 'kits',
			'cookies_tag_id' => null,
			'meta_keywords' => 'DNA methylation Kits,ChIP and ChIP-seq kits,Library preparation kits,MicroChIP/MicroPlex Kit,iDeal Library Preparation Kit',
			'meta_description' => 'Diagenode provides Isotype controls for Methylated DNA Immunoprecipitation',
			'meta_title' => 'Isotype controls for Methylated DNA Immunoprecipitation | Diagenode',
			'modified' => '2019-07-03 10:48:00',
			'created' => '2014-11-13 22:28:36',
			'ProductsCategory' => array(
				[maximum depth reached]
			),
			'CookiesTag' => array([maximum depth reached])
		)
	),
	'Document' => array(
		(int) 0 => array(
			'id' => '1116',
			'name' => 'Datasheet Tagmentase loaded C01070012',
			'description' => '',
			'image_id' => null,
			'type' => 'Datasheet',
			'url' => 'files/products/kits/Datasheet_Tagmentase_loaded_C01070012.pdf',
			'slug' => 'tagmentase-loaded-30-datasheet',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2020-12-10 17:04:06',
			'created' => '2020-12-10 17:04:06',
			'ProductsDocument' => array(
				[maximum depth reached]
			)
		)
	),
	'Feature' => array(),
	'Image' => array(
		(int) 0 => array(
			'id' => '1829',
			'name' => 'https://www.diagenode.com/img/product/kits/tag-loaded.png',
			'alt' => 'Tubes',
			'modified' => '2024-03-28 17:30:39',
			'created' => '2024-03-28 17:30:39',
			'ProductsImage' => array(
				[maximum depth reached]
			)
		)
	),
	'Promotion' => array(),
	'Protocol' => array(),
	'Publication' => array(
		(int) 0 => array(
			'id' => '5002',
			'name' => 'HIRA protects telomeres against R-loop-induced instability in ALT cancer cells',
			'authors' => 'Michelle Lee Lynskey et al.',
			'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HIRA establishes greater telomeric chromatin accessibility after ATRX-DAXX loss</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">Deposition of new H3.3 by HIRA-UBN restricts telomeric ssDNA and TERRA R-loops</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">Unresolved TERRA R-loops block new H3.3 deposition by HIRA-UBN</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">CHK1 phosphorylation of H3.3 is critical to prevent ssDNA and TERRA R-loop buildup</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">Inactivating mutations in chromatin modifiers, like the &alpha;-thalassemia/mental retardation, X-linked (ATRX)-death domain-associated protein (DAXX) chromatin remodeling/histone H3.3 deposition complex, drive the cancer-specific alternative lengthening of telomeres (ALT) pathway. Prior studies revealed that HIRA, another histone H3.3 chaperone, compensates for ATRX-DAXX loss at telomeres to sustain ALT cancer cell survival. How HIRA rescues telomeres from the consequences of ATRX-DAXX deficiency remains unclear. Here, using an assay for transposase-accessible chromatin using sequencing (ATAC-seq) and cleavage under targets and release using nuclease (CUT&amp;RUN), we establish that HIRA-mediated deposition of new H3.3 maintains telomeric chromatin accessibility to prevent the detrimental accumulation of nucleosome-free single-stranded DNA (ssDNA) in ATRX-DAXX-deficient ALT cells. We show that the HIRA-UBN1/UBN2 complex deposits new H3.3 to prevent TERRA R-loop buildup and transcription-replication conflicts (TRCs) at telomeres. Furthermore, HIRA-mediated H3.3 incorporation into telomeric chromatin links productive ALT to the phosphorylation of serine 31, an H3.3-specific amino acid, by Chk1. Therefore, we identify a critical role for HIRA-mediated H3.3 deposition that ensures the survival of ATRX-DAXX-deficient ALT cancer cells.</div>
</section>
<section id="graphical-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name"></h2>
</section>',
			'date' => '2024-11-26',
			'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01315-9',
			'doi' => '10.1016/j.celrep.2024.114964',
			'modified' => '2024-11-12 09:41:40',
			'created' => '2024-11-12 09:41:40',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 1 => array(
			'id' => '4996',
			'name' => 'ARMC5 selectively degrades SCAP-free SREBF1 and is essential for fatty acid desaturation in adipocytes',
			'authors' => 'Akifumi Uota et al.',
			'description' => '<p><span>SREBF1 plays the central role in lipid metabolism. It has been known that full-length SREBF1 that did not associate with SCAP (SCAP-free SREBF1) is actively degraded, but its molecular mechanism and its biological meaning remain unclear. ARMC5-CUL3 complex was recently identified as E3 ubiquitin ligase of full-length SREBF. Although ARMC5 was involved in SREBF pathway in adrenocortical cells, the role of ARMC5 in adipocytes has not been investigated. In this study, adipocyte-specific&nbsp;</span><em>Armc5</em><span><span>&nbsp;</span>knockout mice were generated. In the white adipose tissue (WAT) of these mice, all the stearoyl-CoA desaturase (</span><em>Scd</em><span>) were drastically downregulated. Consistently, unsaturated fatty acids were decreased and saturated fatty acids were increased. The protein amount of full-length SREBF1 were increased, but ATAC-Seq peaks at the SREBF1-binding sites were markedly diminished around the<span>&nbsp;</span></span><em>Scd1</em><span><span>&nbsp;</span>locus in the WAT of<span>&nbsp;</span></span><em>Armc5</em><span><span>&nbsp;</span>knockout mice. Armc5-deficient 3T3-L1 adipocytes also exhibited downregulation of<span>&nbsp;</span></span><em>Scd</em><span>. Mechanistically, disruption of<span>&nbsp;</span></span><em>Armc5</em><span><span>&nbsp;</span>restored decreased full-length SREBF1 in CHO cells deficient for<span>&nbsp;</span></span><em>Scap</em><span>. Overexpression of<span>&nbsp;</span></span><em>Scap</em><span><span>&nbsp;</span>inhibited ARMC5-mediated degradation of full-length SREBF1, and overexpression of<span>&nbsp;</span></span><em>Armc5</em><span><span>&nbsp;</span>increased nuclear SREBF1/full-length SREBF1 ratio and SREBF1 transcriptional activity in the presence of exogenous SCAP. These results demonstrated that ARMC5 selectively removes SCAP-free SREBF1 and stimulates SCAP-mediated SREBF1 processing, hence is essential for fatty acid desaturation<span>&nbsp;</span></span><em>in vivo</em><span>.</span></p>',
			'date' => '2024-11-02',
			'pmid' => 'https://www.sciencedirect.com/science/article/pii/S0021925824024554',
			'doi' => 'https://doi.org/10.1016/j.jbc.2024.107953',
			'modified' => '2024-11-05 08:33:28',
			'created' => '2024-11-05 08:33:28',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 2 => array(
			'id' => '4985',
			'name' => 'HNF1β bookmarking involves Topoisomerase 1 activation and DNA topology relaxation in mitotic chromatin',
			'authors' => 'Alessia Bagattin et al.',
			'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HNF1&beta; mitotic site binding is preserved with a specific methanol/formaldehyde ChIP</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">BTBD2, an HNF1&beta; partner, mediates mitosis-specific interaction with TOP1</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">HNF1&beta; recruits TOP1 and induces DNA relaxation around bookmarked HNF1&beta; sites</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">An HNF1&beta; mutation, found in MODY patients, disrupts the interaction with TOP1</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">HNF1&beta; (<i>HNF1B</i>) is a transcription factor frequently mutated in patients with developmental renal disease. It binds to mitotic chromatin and reactivates gene expression after mitosis, a phenomenon referred to as bookmarking. Using a crosslinking method that circumvents the artifacts of formaldehyde, we demonstrate that&nbsp;HNF1&beta; remains associated with chromatin in a sequence-specific way in both interphase and mitosis. We identify an HNF1&beta;-interacting protein, BTBD2, that enables the interaction and activation of Topoisomerase 1 (TOP1) exclusively during mitosis. Our study identifies a shared microhomology domain between HNF1&beta; and TOP1, where a mutation, found in &ldquo;maturity onset diabetes of the young&rdquo; patients, disrupts their interaction. Importantly, HNF1&beta; recruits TOP1 and induces DNA relaxation around HNF1&beta; mitotic chromatin sites, elucidating its crucial role in chromatin remodeling and gene reactivation after mitotic exit. These findings shed light on how HNF1&beta; reactivates target gene expression after mitosis, providing insights into its crucial role in maintenance of cellular identity.</div>
</section>',
			'date' => '2024-10-08',
			'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01156-2',
			'doi' => '10.1016/j.celrep.2024.114805',
			'modified' => '2024-10-14 09:04:44',
			'created' => '2024-10-14 09:04:44',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 3 => array(
			'id' => '4969',
			'name' => 'Nuclear lamin A/C phosphorylation by loss of androgen receptor leads to cancer-associated fibroblast activation',
			'authors' => 'Ghosh S. et al.',
			'description' => '<p><span>Alterations in nuclear structure and function are hallmarks of cancer cells. Little is known about these changes in Cancer-Associated Fibroblasts (CAFs), crucial components of the&nbsp;tumor microenvironment. Loss of the androgen receptor (AR) in human dermal fibroblasts (HDFs), which triggers early steps of CAF activation, leads to nuclear membrane changes and micronuclei formation, independent of cellular senescence. Similar changes occur in established CAFs and are reversed by restoring AR activity. AR associates with nuclear lamin A/C, and its loss causes lamin A/C nucleoplasmic redistribution. AR serves as a bridge between lamin A/C and the protein phosphatase PPP1. Loss of AR decreases lamin-PPP1 association and increases lamin A/C phosphorylation at Ser 301, a characteristic of CAFs. Phosphorylated lamin A/C at Ser 301 binds to the regulatory region of CAF effector genes of the myofibroblast subtype. Expression of a lamin A/C Ser301 phosphomimetic mutant alone can transform normal fibroblasts into tumor-promoting CAFs.</span></p>',
			'date' => '2024-09-12',
			'pmid' => 'https://www.nature.com/articles/s41467-024-52344-z',
			'doi' => 'https://doi.org/10.1038/s41467-024-52344-z',
			'modified' => '2024-09-16 09:43:31',
			'created' => '2024-09-16 09:43:31',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 4 => array(
			'id' => '4970',
			'name' => 'A critical role for HNF4α in polymicrobial sepsis-associated metabolic reprogramming and death',
			'authors' => 'van Dender C. et al. ',
			'description' => '<p><span>In sepsis, limited food intake and increased energy expenditure induce a starvation response, which is compromised by a quick decline in the expression of hepatic PPAR&alpha;, a transcription factor essential in intracellular catabolism of free fatty acids. The mechanism upstream of this PPAR&alpha; downregulation is unknown. We found that sepsis causes a progressive hepatic loss-of-function of HNF4&alpha;, which has a strong impact on the expression of several important nuclear receptors, including PPAR&alpha;. HNF4&alpha; depletion in hepatocytes dramatically increases sepsis lethality, steatosis, and organ damage and prevents an adequate response to IL6, which is critical for liver regeneration and survival. An HNF4&alpha; agonist protects against sepsis at all levels, irrespectively of bacterial loads, suggesting HNF4&alpha; is crucial in tolerance to sepsis. In conclusion, hepatic HNF4&alpha; activity is decreased during sepsis, causing PPAR&alpha; downregulation, metabolic problems, and a disturbed IL6-mediated acute phase response. The findings provide new insights and therapeutic options in sepsis.</span></p>',
			'date' => '2024-09-11',
			'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/39261648/',
			'doi' => '10.1038/s44321-024-00130-1',
			'modified' => '2024-09-16 09:49:27',
			'created' => '2024-09-16 09:49:27',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 5 => array(
			'id' => '4926',
			'name' => 'High-throughput sequencing of insect specimens with sub-optimal DNA preservation using a practical, plate-based Illumina-compatible Tn5 transposase library preparation method',
			'authors' => 'Cobb L. et all.',
			'description' => '<p><span>Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, which often requires substantial DNA input amounts. Here, we use a practical Tn5 transposase tagmentation-based library preparation method optimised for 96-well plates and low yield DNA extracts from insect legs that were stored under sub-optimal conditions for DNA preservation. The samples were kept in field vehicles for extended periods of time, before long-term storage in ethanol in the freezer, or dry at room temperature. By reducing DNA input to 6ng, more samples with sub-optimal DNA yields could be processed. We matched this low DNA input with a 6-fold dilution of a commercially available tagmentation enzyme, significantly reducing library preparation costs. Costs and workload were further suppressed by direct post-amplification pooling of individual libraries. We generated medium coverage (&gt;3-fold) genomes for 88 out of 90 specimens, with an average of approximately 10-fold coverage. While samples stored in ethanol yielded significantly less DNA compared to those which were stored dry, these samples had superior sequencing statistics, with longer sequencing reads and higher rates of endogenous DNA. Furthermore, we find that the efficiency of tagmentation-based library preparation can be improved by a thorough post-amplification bead clean-up which selects against both short and large DNA fragments. By opening opportunities for the use of sub-optimally preserved, low yield DNA extracts, we broaden the scope of whole genome studies of insect specimens. We therefore expect these results and this protocol to be valuable for a range of applications in the field of entomology.</span></p>',
			'date' => '2024-03-22',
			'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38517905/',
			'doi' => '10.1371/journal.pone.0300865',
			'modified' => '2024-03-25 11:15:06',
			'created' => '2024-03-25 11:15:06',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 6 => array(
			'id' => '4923',
			'name' => 'On the identification of differentially-active transcription factors from ATAC-seq data',
			'authors' => 'Gerbaldo F. et al.',
			'description' => '<p><span>ATAC-seq has emerged as a rich epigenome profiling technique, and is commonly used to identify Transcription Factors (TFs) underlying given phenomena. A number of methods can be used to identify differentially-active TFs through the accessibility of their DNA-binding motif, however little is known on the best approaches for doing so. Here we benchmark several such methods using a combination of curated datasets with various forms of short-term perturbations on known TFs, as well as semi-simulations. We include both methods specifically designed for this type of data as well as some that can be repurposed for it. We also investigate variations to these methods, and identify three particularly promising approaches (chromVAR-limma with critical adjustments, monaLisa and a combination of GC smooth quantile normalization and multivariate modeling). We further investigate the specific use of nucleosome-free fragments, the combination of top methods, and the impact of technical variation. Finally, we illustrate the use of the top methods on a novel dataset to characterize the impact on DNA accessibility of TRAnscription Factor TArgeting Chimeras (TRAFTAC), which can deplete TFs &ndash; in our case NFkB &ndash; at the protein level.</span></p>',
			'date' => '2024-03-10',
			'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.03.06.583825v2',
			'doi' => 'https://doi.org/10.1101/2024.03.06.583825',
			'modified' => '2024-03-13 17:04:33',
			'created' => '2024-03-13 17:04:33',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 7 => array(
			'id' => '4918',
			'name' => 'Cellular reprogramming in vivo initiated by SOX4 pioneer factor activity',
			'authors' => 'Katsuda T.',
			'description' => '<p><span>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate &ldquo;reprogramming&rdquo; by opening new chromatin sites for expression that can attract transcription factors from the starting cell&rsquo;s enhancers. Here we report that SOX4 is sufficient to initiate hepatobiliary metaplasia in the adult mouse liver, closely mimicking metaplasia initiated by toxic damage to the liver. In lineage-traced cells, we assessed the timing of SOX4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, SOX4 directly binds to and closes hepatocyte regulatory sequences via an overlapping motif with HNF4A, a hepatocyte master regulatory transcription factor. Subsequently, SOX4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</span></p>',
			'date' => '2024-02-26',
			'pmid' => 'https://www.nature.com/articles/s41467-024-45939-z',
			'doi' => 'https://doi.org/10.1038/s41467-024-45939-z',
			'modified' => '2024-02-29 11:59:10',
			'created' => '2024-02-29 11:59:10',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 8 => array(
			'id' => '4889',
			'name' => 'The ncBAF complex regulates transcription in AML through H3K27ac sensing by BRD9',
			'authors' => 'Klein D.C. et al. ',
			'description' => '<p><span>The non-canonical BAF complex (ncBAF) subunit BRD9 is essential for acute myeloid leukemia (AML) cell viability but has an unclear role in leukemogenesis. Because BRD9 is required for ncBAF complex assembly through its DUF3512 domain, precise bromodomain inhibition is necessary to parse the role of BRD9 as a transcriptional regulator from that of a scaffolding protein. To understand the role of BRD9 bromodomain function in regulating AML, we selected a panel of five AML cell lines with distinct driver mutations, disease classifications, and genomic aberrations and subjected these cells to short-term BRD9 bromodomain inhibition. We examined the bromodomain-dependent growth of these cell lines, identifying a dependency in AML cell lines but not HEK293T cells. To define a mechanism through which BRD9 maintains AML cell survival, we examined nascent transcription, chromatin accessibility, and ncBAF complex binding genome-wide after bromodomain inhibition. We identified extensive regulation of transcription by BRD9 bromodomain activity, including repression of myeloid maturation factors and tumor suppressor genes, while standard AML chemotherapy targets were repressed by inhibition of the BRD9 bromodomain. BRD9 bromodomain activity maintained accessible chromatin at both gene promoters and gene-distal putative enhancer regions, in a manner that qualitatively correlated with enrichment of BRD9 binding. Furthermore, we identified reduced chromatin accessibility at GATA, ETS, and AP-1 motifs and increased chromatin accessibility at SNAIL-, HIC-, and TP53-recognized motifs after BRD9 inhibition. These data suggest a role for BRD9 in regulating AML cell differentiation through modulation of accessibility at hematopoietic transcription factor binding sites.</span></p>',
			'date' => '2023-12-21',
			'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38126767/',
			'doi' => '10.1158/2767-9764.CRC-23-0382',
			'modified' => '2024-01-02 11:07:14',
			'created' => '2024-01-02 11:07:14',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 9 => array(
			'id' => '4878',
			'name' => 'ARID1A governs the silencing of sex-linked transcription during male meiosis in the mouse',
			'authors' => 'Menon D.U. et al.',
			'description' => '<p><span>We present evidence implicating the BAF (BRG1/BRM Associated Factor) chromatin remodeler in meiotic sex chromosome inactivation (MSCI). By immunofluorescence (IF), the putative BAF DNA binding subunit, ARID1A (AT-rich Interaction Domain 1a), appeared enriched on the male sex chromosomes during diplonema of meiosis I. The germ cell-specific depletion of ARID1A resulted in a pachynema arrest and failure to repress sex-linked genes, indicating a defective MSCI. Consistent with this defect, mutant sex chromosomes displayed an abnormal presence of elongating RNA polymerase II coupled with an overall increase in chromatin accessibility detectable by ATAC-seq. By investigating potential mechanisms underlying these anomalies, we identified a role for ARID1A in promoting the preferential enrichment of the histone variant, H3.3, on the sex chromosomes, a known hallmark of MSCI. Without ARID1A, the sex chromosomes appeared depleted of H3.3 at levels resembling autosomes. Higher resolution analyses by CUT&amp;RUN revealed shifts in sex-linked H3.3 associations from discrete intergenic sites and broader gene-body domains to promoters in response to the loss of ARID1A. Several sex-linked sites displayed ectopic H3.3 occupancy that did not co-localize with DMC1 (DNA Meiotic Recombinase 1). This observation suggests a requirement for ARID1A in DMC1 localization to the asynapsed sex chromatids. We conclude that ARID1A-directed H3.3 localization influences meiotic sex chromosome gene regulation and DNA repair.</span></p>',
			'date' => '2023-09-28',
			'pmid' => 'https://www.biorxiv.org/content/10.1101/2023.05.25.542290v2.abstract',
			'doi' => 'https://doi.org/10.1101/2023.05.25.542290',
			'modified' => '2023-11-10 14:53:09',
			'created' => '2023-11-10 14:53:09',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 10 => array(
			'id' => '4825',
			'name' => 'Zfp296 knockout enhances chromatin accessibility and induces a uniquestate of pluripotency in embryonic stem cells.',
			'authors' => 'Miyazaki  S. et al.',
			'description' => '<p>The Zfp296 gene encodes a zinc finger-type protein. Its expression is high in mouse embryonic stem cells (ESCs) but rapidly decreases following differentiation. Zfp296-knockout (KO) ESCs grew as flat colonies, which were reverted to rounded colonies by exogenous expression of Zfp296. KO ESCs could not form teratomas when transplanted into mice but could efficiently contribute to germline-competent chimeric mice following blastocyst injection. Transcriptome analysis revealed that Zfp296 deficiency up- and down-regulates a distinct group of genes, among which Dppa3, Otx2, and Pou3f1 were markedly downregulated. Chromatin immunoprecipitation sequencing demonstrated that ZFP296 binding is predominantly seen in the vicinity of the transcription start sites (TSSs) of a number of genes, and ZFP296 was suggested to negatively regulate transcription. Consistently, chromatin accessibility assay clearly showed that ZFP296 binding reduces the accessibility of the TSS regions of target genes. Zfp296-KO ESCs showed increased histone H3K9 di- and trimethylation. Co-immunoprecipitation analyses revealed interaction of ZFP296 with G9a and GLP. These results show that ZFP296 plays essential roles in maintaining the global epigenetic state of ESCs through multiple mechanisms including activation of Dppa3, attenuation of chromatin accessibility, and repression of H3K9 methylation, but that Zfp296-KO ESCs retain a unique state of pluripotency while lacking the teratoma-forming ability.</p>',
			'date' => '2023-07-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37488353',
			'doi' => '10.1038/s42003-023-05148-8',
			'modified' => '2023-08-01 13:30:58',
			'created' => '2023-08-01 15:59:38',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 11 => array(
			'id' => '4817',
			'name' => 'YAP/BRD4-controlled ROR1 promotes tumor-initiating cells andhyperproliferation in pancreatic cancer.',
			'authors' => 'Yamazaki  M. et al.',
			'description' => '<p><span>Tumor-initiating cells are major drivers of chemoresistance and attractive targets for cancer therapy, however, their identity in human pancreatic ductal adenocarcinoma (PDAC) and the key molecules underlying their traits remain poorly understood. Here, we show that a cellular subpopulation with partial epithelial-mesenchymal transition (EMT)-like signature marked by high expression of receptor tyrosine kinase-like orphan receptor 1 (ROR1) is the origin of heterogeneous tumor cells in PDAC. We demonstrate that ROR1 depletion suppresses tumor growth, recurrence after chemotherapy, and metastasis. Mechanistically, ROR1 induces the expression of Aurora kinase B (AURKB) by activating E2F through c-Myc to enhance PDAC proliferation. Furthermore, epigenomic analyses reveal that ROR1 is transcriptionally dependent on YAP/BRD4 binding at the enhancer region, and targeting this pathway reduces ROR1 expression and prevents PDAC growth. Collectively, our findings reveal a critical role for ROR1high cells as tumor-initiating cells and the functional importance of ROR1 in PDAC progression, thereby highlighting its therapeutic targetability.</span></p>',
			'date' => '2023-04-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37096681',
			'doi' => '10.15252/embj.2022112614',
			'modified' => '2023-06-15 10:06:12',
			'created' => '2023-06-13 21:11:31',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 12 => array(
			'id' => '4757',
			'name' => 'Analyzing genomic and epigenetic profiles in single cells by hybridtransposase (scGET-seq).',
			'authors' => 'Cittaro  D. et al.',
			'description' => '<p>scGET-seq simultaneously profiles euchromatin and heterochromatin. scGET-seq exploits the concurrent action of transposase Tn5 and its hybrid form TnH, which targets H3K9me3 domains. Here we present a step-by-step protocol to profile single cells by scGET-seq using a 10&Atilde;&mdash; Chromium Controller. We describe steps for transposomes preparation and validation. We detail nuclei preparation and transposition, followed by encapsulation, library preparation, sequencing, and data analysis. For complete details on the use and execution of this protocol, please refer to Tedesco et&Acirc;&nbsp;al. (2022) and de Pretis and Cittaro (2022)..</p>',
			'date' => '2023-03-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37000619',
			'doi' => '10.1016/j.xpro.2023.102176',
			'modified' => '2023-04-17 09:04:55',
			'created' => '2023-04-14 13:41:22',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 13 => array(
			'id' => '4742',
			'name' => 'A neurodevelopmental epigenetic programme mediated bySMARCD3-DAB1-Reelin signalling is hijacked to promote medulloblastomametastasis.',
			'authors' => 'Zou  Han et al.',
			'description' => '<p>How abnormal neurodevelopment relates to the tumour aggressiveness of medulloblastoma (MB), the most common type of embryonal tumour, remains elusive. Here we uncover a neurodevelopmental epigenomic programme that is hijacked to induce MB metastatic dissemination. Unsupervised analyses of integrated publicly available datasets with our newly generated data reveal that SMARCD3 (also known as BAF60C) regulates Disabled&acirc;&euro;&permil;1 (DAB1)-mediated Reelin signalling in Purkinje cell migration and MB metastasis by orchestrating cis-regulatory elements at the DAB1 locus. We further identify that a core set of transcription factors, enhancer of zeste homologue&acirc;&euro;&permil;2 (EZH2) and nuclear factor&acirc;&euro;&permil;I&acirc;&euro;&permil;X (NFIX), coordinates with the cis-regulatory elements at the SMARCD3 locus to form a chromatin hub to control SMARCD3 expression in the developing cerebellum and in metastatic MB. Increased SMARCD3 expression activates Reelin-DAB1-mediated Src kinase signalling, which results in a MB response to Src inhibition. These data deepen our understanding of how neurodevelopmental programming influences disease progression and provide a potential therapeutic option for patients with MB.</p>',
			'date' => '2023-02-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/36849558',
			'doi' => '10.1038/s41556-023-01093-0',
			'modified' => '2023-03-14 09:41:24',
			'created' => '2023-03-02 17:27:08',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 14 => array(
			'id' => '4568',
			'name' => 'Physiological reprogramming in vivo mediated by Sox4 pioneer factoractivity',
			'authors' => 'Katsuda  T. et al.',
			'description' => '<p>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate &ldquo;reprogramming&rdquo; by opening new chromatin sites for expression that can attract transcription factors from the starting cell&rsquo;s enhancers. Here we report that Sox4 is sufficient to initiate hepatobiliary metaplasia in the adult liver. In lineage-traced cells, we assessed the timing of Sox4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, Sox4 directly binds to and closes hepatocyte regulatory sequences via a motif it overlaps with Hnf4a, a hepatocyte master regulator. Subsequently, Sox4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</p>',
			'date' => '2023-01-01',
			'pmid' => 'https://doi.org/10.1101%2F2023.02.14.528556',
			'doi' => '10.1101/2023.02.14.528556',
			'modified' => '2023-04-11 10:26:02',
			'created' => '2023-02-21 09:59:46',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 15 => array(
			'id' => '4660',
			'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
			'authors' => 'Zolotarev  Nikolay et al.',
			'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to na&iuml;ve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
			'date' => '2022-11-01',
			'pmid' => 'https://doi.org/10.1073%2Fpnas',
			'doi' => '10.1073/pnas.2210595119',
			'modified' => '2023-03-07 09:07:41',
			'created' => '2023-02-21 09:59:46',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		)
	),
	'Testimonial' => array(
		(int) 0 => array(
			'id' => '82',
			'name' => 'Tagmentase',
			'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
			'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
			'featured' => true,
			'slug' => 'testimonial-tagmentase',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2023-02-08 09:40:13',
			'created' => '2023-02-08 09:37:00',
			'ProductsTestimonial' => array(
				[maximum depth reached]
			)
		)
	),
	'Area' => array(),
	'SafetySheet' => array(
		(int) 0 => array(
			'id' => '2128',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS US en',
			'language' => 'en',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-US-en-GHS_1_0.pdf',
			'countries' => 'US',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 1 => array(
			'id' => '2126',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS GB en',
			'language' => 'en',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-GB-en-GHS_1_0.pdf',
			'countries' => 'GB',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 2 => array(
			'id' => '2121',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS BE fr',
			'language' => 'fr',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-BE-fr-GHS_1_0.pdf',
			'countries' => 'BE',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 3 => array(
			'id' => '2125',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS FR fr',
			'language' => 'fr',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-FR-fr-GHS_1_0.pdf',
			'countries' => 'FR',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 4 => array(
			'id' => '2124',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS ES es',
			'language' => 'es',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-ES-es-GHS_1_0.pdf',
			'countries' => 'ES',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 5 => array(
			'id' => '2123',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS DE de',
			'language' => 'de',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-DE-de-GHS_1_0.pdf',
			'countries' => 'DE',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 6 => array(
			'id' => '2127',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS JP ja',
			'language' => 'ja',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-JP-ja-GHS_2_0.pdf',
			'countries' => 'JP',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 7 => array(
			'id' => '2122',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS BE nl',
			'language' => 'nl',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-BE-nl-GHS_1_0.pdf',
			'countries' => 'BE',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		)
	)
)
$meta_canonical = 'https://www.diagenode.com/cn/p/tagmentase-loaded-30'
$country = 'US'
$countries_allowed = array(
	(int) 0 => 'CA',
	(int) 1 => 'US',
	(int) 2 => 'IE',
	(int) 3 => 'GB',
	(int) 4 => 'DK',
	(int) 5 => 'NO',
	(int) 6 => 'SE',
	(int) 7 => 'FI',
	(int) 8 => 'NL',
	(int) 9 => 'BE',
	(int) 10 => 'LU',
	(int) 11 => 'FR',
	(int) 12 => 'DE',
	(int) 13 => 'CH',
	(int) 14 => 'AT',
	(int) 15 => 'ES',
	(int) 16 => 'IT',
	(int) 17 => 'PT'
)
$outsource = true
$other_formats = array(
	(int) 0 => array(
		'id' => '3164',
		'antibody_id' => null,
		'name' => 'Tagmentase (Tn5 transposase) - loaded',
		'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns">
<p>&nbsp;</p>
<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
		'label1' => 'Examples of results',
		'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label2' => 'Product information',
		'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span> 3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span> correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions: </strong>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong> Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong> Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div>ATAC-seq package for tissue, Cat. No.&nbsp;<span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label3' => '',
		'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'format' => '30 μl',
		'catalog_number' => 'C01070012-30',
		'old_catalog_number' => '',
		'sf_code' => 'C01070012-143301',
		'type' => 'FRE',
		'search_order' => '',
		'price_EUR' => '330',
		'price_USD' => '330',
		'price_GBP' => '300',
		'price_JPY' => '51695',
		'price_CNY' => '',
		'price_AUD' => '825',
		'country' => 'ALL',
		'except_countries' => 'None',
		'quote' => false,
		'in_stock' => false,
		'featured' => true,
		'no_promo' => false,
		'online' => true,
		'master' => true,
		'last_datasheet_update' => '',
		'slug' => 'tagmentase-loaded-30',
		'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 30 | Diagenode',
		'meta_keywords' => '',
		'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
		'modified' => '2024-09-13 15:36:59',
		'created' => '2020-12-08 16:15:40'
	),
	(int) 1 => array(
		'id' => '3205',
		'antibody_id' => null,
		'name' => 'Tagmentase (Tn5 transposase) - loaded',
		'description' => '<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
		'label1' => 'Examples of results',
		'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label2' => 'Product information',
		'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span><span>&nbsp;</span>3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span><span>&nbsp;</span>correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions:</strong><span>&nbsp;</span>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong><span>&nbsp;</span>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage:&nbsp;</strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong><span>&nbsp;</span>Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div><span>ATAC-seq package for tissue, Cat. No.&nbsp;</span><span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label3' => '',
		'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'format' => '200 μl',
		'catalog_number' => 'C01070012-200',
		'old_catalog_number' => '',
		'sf_code' => 'C01070012-93190',
		'type' => 'FRE',
		'search_order' => '',
		'price_EUR' => '2090',
		'price_USD' => '2090',
		'price_GBP' => '1800',
		'price_JPY' => '327400',
		'price_CNY' => '0',
		'price_AUD' => '5225',
		'country' => 'ALL',
		'except_countries' => 'None',
		'quote' => true,
		'in_stock' => false,
		'featured' => false,
		'no_promo' => false,
		'online' => true,
		'master' => false,
		'last_datasheet_update' => '',
		'slug' => 'tagmentase-loaded-200',
		'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Diagenode',
		'meta_keywords' => '',
		'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
		'modified' => '2024-09-13 15:37:53',
		'created' => '2021-10-21 11:35:59',
		'ProductsGroup' => array(
			'id' => '400',
			'product_id' => '3205',
			'group_id' => '331'
		)
	)
)
$pro = array(
	'id' => '3205',
	'antibody_id' => null,
	'name' => 'Tagmentase (Tn5 transposase) - loaded',
	'description' => '<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
	'label1' => 'Examples of results',
	'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label2' => 'Product information',
	'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span><span>&nbsp;</span>3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span><span>&nbsp;</span>correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions:</strong><span>&nbsp;</span>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong><span>&nbsp;</span>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage:&nbsp;</strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong><span>&nbsp;</span>Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div><span>ATAC-seq package for tissue, Cat. No.&nbsp;</span><span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label3' => '',
	'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'format' => '200 μl',
	'catalog_number' => 'C01070012-200',
	'old_catalog_number' => '',
	'sf_code' => 'C01070012-93190',
	'type' => 'FRE',
	'search_order' => '',
	'price_EUR' => '2090',
	'price_USD' => '2090',
	'price_GBP' => '1800',
	'price_JPY' => '327400',
	'price_CNY' => '0',
	'price_AUD' => '5225',
	'country' => 'ALL',
	'except_countries' => 'None',
	'quote' => true,
	'in_stock' => false,
	'featured' => false,
	'no_promo' => false,
	'online' => true,
	'master' => false,
	'last_datasheet_update' => '',
	'slug' => 'tagmentase-loaded-200',
	'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Diagenode',
	'meta_keywords' => '',
	'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
	'modified' => '2024-09-13 15:37:53',
	'created' => '2021-10-21 11:35:59',
	'ProductsGroup' => array(
		'id' => '400',
		'product_id' => '3205',
		'group_id' => '331'
	)
)
$edit = ''
$testimonials = ''
$featured_testimonials = '<blockquote><span class="label-green" style="margin-bottom:16px;margin-left:-22px">TESTIMONIAL</span><p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p><cite>Julia Liz Touza, AstraZeneca Gothenburg, Sweden</cite></blockquote>
'
$testimonial = array(
	'id' => '82',
	'name' => 'Tagmentase',
	'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
	'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
	'featured' => true,
	'slug' => 'testimonial-tagmentase',
	'meta_keywords' => '',
	'meta_description' => '',
	'modified' => '2023-02-08 09:40:13',
	'created' => '2023-02-08 09:37:00',
	'ProductsTestimonial' => array(
		'id' => '200',
		'product_id' => '3165',
		'testimonial_id' => '82'
	)
)
$related_products = '<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/tagmentation-buffer-2x"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01019043</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3162" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3162" id="CartAdd/3162Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3162" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> Tagmentation Buffer (2x)</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
                    'C01019043',
                     '100',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
                    'C01019043',
                    '100',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="tagmentation-buffer-2x" data-reveal-id="cartModal-3162" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">Tagmentation Buffer (2x)</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/24-unique-dual-indexes-for-tagmented-libraries-set1"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01011034</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3158" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3158" id="CartAdd/3158Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3158" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for Tagmented libraries - Set I</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
                    'C01011034',
                     '185',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
                    'C01011034',
                    '185',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set1" data-reveal-id="cartModal-3158" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">24 UDI for Tagmented libraries - Set I</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/atac-seq-kit-24rxns"><img src="/img/product/kits/atacseq-kit-picture.jpg" alt="ATAC-seq kit" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01080002</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3194" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3194" id="CartAdd/3194Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3194" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ATAC-seq kit</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq kit',
                    'C01080002',
                     '1745',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq kit',
                    'C01080002',
                    '1745',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="atac-seq-kit-24rxns" data-reveal-id="cartModal-3194" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">ATAC-seq kit</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/ATAC-seq-package-tissue-C01080006"><img src="/img/grey-logo.jpg" alt="default alt" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01080006</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3215" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3215" id="CartAdd/3215Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3215" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ATAC-seq package for tissue</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
                    'C01080006',
                     '2050',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
                    'C01080006',
                    '2050',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="ATAC-seq-package-tissue-C01080006" data-reveal-id="cartModal-3215" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">ATAC-seq package for tissue</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/tagmentase"><img src="https://www.diagenode.com/img/product/kits/tag-unloaded.png" alt="Tubes" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01070010-10</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3057" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3057" id="CartAdd/3057Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3057" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> Tagmentase (Tn5 transposase) - unloaded</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentase (Tn5 transposase) - unloaded',
                    'C01070010-10',
                     '355',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentase (Tn5 transposase) - unloaded',
                    'C01070010-10',
                    '355',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="tagmentase" data-reveal-id="cartModal-3057" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">Tagmentase</h6>
        </div>

    </div>
</li>
'
$related = array(
	'id' => '3057',
	'antibody_id' => null,
	'name' => 'Tagmentase (Tn5 transposase) - unloaded',
	'description' => '<div class="extra-spaced"><center><img alt="Tagmentase (Tn5 transposase)" src="https://www.diagenode.com/img/banners/banner-tagmentase.jpg" caption="false" width="787" height="236" /></center></div>
<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode Tagmentase is a hyperactive Tn5 transposase with the potential to enhance epigenetic studies. Its ability to cut DNA and insert sequences of interest in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq, ChIPmentation, CHANGE-seq and other. The enzyme is not loaded with DNA oligos, providing flexibility of application. To ensure optimal results the concentration may be adjusted with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> (Cat. No. C01070011), available separately.</p>
<p><a href="https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf" target="_blank">Protocol for transposome assembly</a></p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) you may also need:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for loaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) - loaded</a>.</p>',
	'label1' => 'Quality control',
	'info1' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><img alt="Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1a.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="653" height="282" /></p>
<p><img alt="Tagmentase Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1b.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="645" height="278" /></p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 1: Efficient fragmentation of the lambda DNA after incubation with the Tagmentase</strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with diluted Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). Profiles show the size of lambda DNA before (A) and after treatment with Tagmentase (B).</p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns"><center><img alt="Tn5 transposase perfect for NGS" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure2.jpg" width="754" height="492" /></center></div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 2: Fragmentation efficiency depending on the amount of Tagmentase </strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The Tagmentase was previously diluted with the Tagmentase Dilution Buffer (Cat. No.) at &frac14; and 1/16 dilutions. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). The migration of the samples shows variations of the size distribution according to the amount of Tagmentase used for the reaction.</p>
</div>
</div>',
	'label2' => 'Product information',
	'info2' => '<p><strong>Tagmentase (Tn5 transposase) - unloaded</strong></p>
<div><span style="font-family: inherit;">Protein Molecular weight: 53.3 kDa</span></div>
<p>Expressed: in Escherichia coli</p>
<p><strong>Product description:</strong> Diagenode Tagmentase &ndash; unloaded is a hyperactive Tn5 transposase. The enzyme catalyzes &ldquo;cut and paste&rdquo; tagmentation reaction and can be used to insert any target DNA in vitro.</p>
<p><strong>Storage conditions:</strong> Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer: </strong>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>The enzyme should be loaded with appropriate oligonucleotides prior to use. An efficient transposition require that insert DNA have a specific 19-bp transposase recognition sequence (Mosaic End or ME sequence) at each of its ends. The transposome assembly protocol can be found at https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications: </strong>Tagmentase (Tn5 transposase) &ndash; unloaded can be used in a variety of applications including transgenic experiments, barcoding and library construction for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label3' => '',
	'info3' => '<p></p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'format' => '10 µl',
	'catalog_number' => 'C01070010-10',
	'old_catalog_number' => '',
	'sf_code' => 'C01070010-19650',
	'type' => 'FRE',
	'search_order' => '',
	'price_EUR' => '355',
	'price_USD' => '355',
	'price_GBP' => '320',
	'price_JPY' => '55610',
	'price_CNY' => '0',
	'price_AUD' => '888',
	'country' => 'ALL',
	'except_countries' => 'None',
	'quote' => false,
	'in_stock' => false,
	'featured' => false,
	'no_promo' => false,
	'online' => true,
	'master' => true,
	'last_datasheet_update' => '',
	'slug' => 'tagmentase',
	'meta_title' => 'Tagmentase (Tn5 transposase) -unloaded | Diagenode',
	'meta_keywords' => '',
	'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. The enzyme is not loaded with DNA oligos, providing flexibility of application.',
	'modified' => '2024-09-13 15:48:15',
	'created' => '2020-03-24 17:33:04',
	'ProductsRelated' => array(
		'id' => '4923',
		'product_id' => '3165',
		'related_id' => '3057'
	),
	'Image' => array(
		(int) 0 => array(
			'id' => '1828',
			'name' => 'https://www.diagenode.com/img/product/kits/tag-unloaded.png',
			'alt' => 'Tubes',
			'modified' => '2024-03-28 17:29:30',
			'created' => '2024-03-28 17:29:30',
			'ProductsImage' => array(
				[maximum depth reached]
			)
		)
	)
)
$rrbs_service = array(
	(int) 0 => (int) 1894,
	(int) 1 => (int) 1895
)
$chipseq_service = array(
	(int) 0 => (int) 2683,
	(int) 1 => (int) 1835,
	(int) 2 => (int) 1836,
	(int) 3 => (int) 2684,
	(int) 4 => (int) 1838,
	(int) 5 => (int) 1839,
	(int) 6 => (int) 1856
)
$labelize = object(Closure) {
	
}
$old_catalog_number = ''
$country_code = 'US'
$other_format = array(
	'id' => '3205',
	'antibody_id' => null,
	'name' => 'Tagmentase (Tn5 transposase) - loaded',
	'description' => '<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
	'label1' => 'Examples of results',
	'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label2' => 'Product information',
	'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span><span>&nbsp;</span>3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span><span>&nbsp;</span>correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions:</strong><span>&nbsp;</span>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong><span>&nbsp;</span>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage:&nbsp;</strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong><span>&nbsp;</span>Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div><span>ATAC-seq package for tissue, Cat. No.&nbsp;</span><span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label3' => '',
	'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'format' => '200 μl',
	'catalog_number' => 'C01070012-200',
	'old_catalog_number' => '',
	'sf_code' => 'C01070012-93190',
	'type' => 'FRE',
	'search_order' => '',
	'price_EUR' => '2090',
	'price_USD' => '2090',
	'price_GBP' => '1800',
	'price_JPY' => '327400',
	'price_CNY' => '0',
	'price_AUD' => '5225',
	'country' => 'ALL',
	'except_countries' => 'None',
	'quote' => true,
	'in_stock' => false,
	'featured' => false,
	'no_promo' => false,
	'online' => true,
	'master' => false,
	'last_datasheet_update' => '',
	'slug' => 'tagmentase-loaded-200',
	'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Diagenode',
	'meta_keywords' => '',
	'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
	'modified' => '2024-09-13 15:37:53',
	'created' => '2021-10-21 11:35:59',
	'ProductsGroup' => array(
		'id' => '400',
		'product_id' => '3205',
		'group_id' => '331'
	)
)
$label = '<img src="/img/banners/banner-customizer-back.png" alt=""/>'
$document = array(
	'id' => '1116',
	'name' => 'Datasheet Tagmentase loaded C01070012',
	'description' => '',
	'image_id' => null,
	'type' => 'Datasheet',
	'url' => 'files/products/kits/Datasheet_Tagmentase_loaded_C01070012.pdf',
	'slug' => 'tagmentase-loaded-30-datasheet',
	'meta_keywords' => '',
	'meta_description' => '',
	'modified' => '2020-12-10 17:04:06',
	'created' => '2020-12-10 17:04:06',
	'ProductsDocument' => array(
		'id' => '3059',
		'product_id' => '3165',
		'document_id' => '1116'
	)
)
$sds = array(
	'id' => '2122',
	'name' => 'Tagmentase (Tn5 transposase) - loaded SDS BE nl',
	'language' => 'nl',
	'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-BE-nl-GHS_1_0.pdf',
	'countries' => 'BE',
	'modified' => '2021-10-12 14:34:34',
	'created' => '2021-10-12 14:34:34',
	'ProductsSafetySheet' => array(
		'id' => '3675',
		'product_id' => '3165',
		'safety_sheet_id' => '2122'
	)
)
$publication = array(
	'id' => '4660',
	'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
	'authors' => 'Zolotarev  Nikolay et al.',
	'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to na&iuml;ve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
	'date' => '2022-11-01',
	'pmid' => 'https://doi.org/10.1073%2Fpnas',
	'doi' => '10.1073/pnas.2210595119',
	'modified' => '2023-03-07 09:07:41',
	'created' => '2023-02-21 09:59:46',
	'ProductsPublication' => array(
		'id' => '6552',
		'product_id' => '3165',
		'publication_id' => '4660'
	)
)
$externalLink = ' <a href="https://doi.org/10.1073%2Fpnas" target="_blank"><i class="fa fa-external-link"></i></a>'
include - APP/View/Products/view.ctp, line 755
View::_evaluate() - CORE/Cake/View/View.php, line 971
View::_render() - CORE/Cake/View/View.php, line 933
View::render() - CORE/Cake/View/View.php, line 473
Controller::render() - CORE/Cake/Controller/Controller.php, line 963
ProductsController::slug() - APP/Controller/ProductsController.php, line 1052
ReflectionMethod::invokeArgs() - [internal], line ??
Controller::invokeAction() - CORE/Cake/Controller/Controller.php, line 491
Dispatcher::_invoke() - CORE/Cake/Routing/Dispatcher.php, line 193
Dispatcher::dispatch() - CORE/Cake/Routing/Dispatcher.php, line 167
[main] - APP/webroot/index.php, line 118

Notice (8): Undefined variable: header [APP/View/Products/view.ctp, line 755]Code Context<!-- BEGIN: REQUEST_FORM MODAL -->
<div id="request_formModal" class="reveal-modal medium" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
    <?= $this->element('Forms/simple_form', array('solution_of_interest' => $solution_of_interest, 'header' => $header, 'message' => $message, 'campaign_id' => $campaign_id)) ?>
$viewFile = '/home/website-server/www/app/View/Products/view.ctp'
$dataForView = array(
	'language' => 'cn',
	'meta_keywords' => '',
	'meta_description' => '',
	'meta_title' => 'Tagmentase - loaded - 10',
	'product' => array(
		'Product' => array(
			'id' => '3165',
			'antibody_id' => null,
			'name' => 'Tagmentase (Tn5 transposase) – loaded EARLY ACCESS',
			'description' => '',
			'label1' => '',
			'info1' => '',
			'label2' => '',
			'info2' => '',
			'label3' => '',
			'info3' => '',
			'format' => '10 µl',
			'catalog_number' => 'C01070012-10',
			'old_catalog_number' => '',
			'sf_code' => 'C01070012-19650',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '120',
			'price_USD' => '120',
			'price_GBP' => '115',
			'price_JPY' => '18800',
			'price_CNY' => '',
			'price_AUD' => '300',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => false,
			'last_datasheet_update' => '',
			'slug' => 'tagmentase-loaded-10',
			'meta_title' => 'Tagmentase - loaded - 10',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2024-09-13 14:26:44',
			'created' => '2020-12-08 16:17:54',
			'locale' => 'zho'
		),
		'Antibody' => array(
			'host' => '*****',
			'id' => null,
			'name' => null,
			'description' => null,
			'clonality' => null,
			'isotype' => null,
			'lot' => null,
			'concentration' => null,
			'reactivity' => null,
			'type' => null,
			'purity' => null,
			'classification' => null,
			'application_table' => null,
			'storage_conditions' => null,
			'storage_buffer' => null,
			'precautions' => null,
			'uniprot_acc' => null,
			'slug' => null,
			'meta_keywords' => null,
			'meta_description' => null,
			'modified' => null,
			'created' => null,
			'select_label' => null
		),
		'Slave' => array(),
		'Group' => array(
			'Group' => array(
				[maximum depth reached]
			),
			'Master' => array(
				[maximum depth reached]
			),
			'Product' => array(
				[maximum depth reached]
			)
		),
		'Related' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			),
			(int) 2 => array(
				[maximum depth reached]
			),
			(int) 3 => array(
				[maximum depth reached]
			),
			(int) 4 => array(
				[maximum depth reached]
			)
		),
		'Application' => array(),
		'Category' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Document' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Feature' => array(),
		'Image' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Promotion' => array(),
		'Protocol' => array(),
		'Publication' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			),
			(int) 2 => array(
				[maximum depth reached]
			),
			(int) 3 => array(
				[maximum depth reached]
			),
			(int) 4 => array(
				[maximum depth reached]
			),
			(int) 5 => array(
				[maximum depth reached]
			),
			(int) 6 => array(
				[maximum depth reached]
			),
			(int) 7 => array(
				[maximum depth reached]
			),
			(int) 8 => array(
				[maximum depth reached]
			),
			(int) 9 => array(
				[maximum depth reached]
			),
			(int) 10 => array(
				[maximum depth reached]
			),
			(int) 11 => array(
				[maximum depth reached]
			),
			(int) 12 => array(
				[maximum depth reached]
			),
			(int) 13 => array(
				[maximum depth reached]
			),
			(int) 14 => array(
				[maximum depth reached]
			),
			(int) 15 => array(
				[maximum depth reached]
			)
		),
		'Testimonial' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Area' => array(),
		'SafetySheet' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			),
			(int) 2 => array(
				[maximum depth reached]
			),
			(int) 3 => array(
				[maximum depth reached]
			),
			(int) 4 => array(
				[maximum depth reached]
			),
			(int) 5 => array(
				[maximum depth reached]
			),
			(int) 6 => array(
				[maximum depth reached]
			),
			(int) 7 => array(
				[maximum depth reached]
			)
		)
	),
	'meta_canonical' => 'https://www.diagenode.com/cn/p/tagmentase-loaded-30'
)
$language = 'cn'
$meta_keywords = ''
$meta_description = ''
$meta_title = 'Tagmentase - loaded - 10'
$product = array(
	'Product' => array(
		'id' => '3165',
		'antibody_id' => null,
		'name' => 'Tagmentase (Tn5 transposase) – loaded EARLY ACCESS',
		'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns">
<p>&nbsp;</p>
<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
		'label1' => 'Examples of results',
		'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label2' => 'Product information',
		'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span> 3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span> correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions: </strong>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong> Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong> Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div>ATAC-seq package for tissue, Cat. No.&nbsp;<span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label3' => '',
		'info3' => '',
		'format' => '10 µl',
		'catalog_number' => 'C01070012-10',
		'old_catalog_number' => '',
		'sf_code' => 'C01070012-19650',
		'type' => 'FRE',
		'search_order' => '',
		'price_EUR' => '120',
		'price_USD' => '120',
		'price_GBP' => '115',
		'price_JPY' => '18800',
		'price_CNY' => '',
		'price_AUD' => '300',
		'country' => 'ALL',
		'except_countries' => 'None',
		'quote' => false,
		'in_stock' => false,
		'featured' => false,
		'no_promo' => false,
		'online' => true,
		'master' => false,
		'last_datasheet_update' => '',
		'slug' => 'tagmentase-loaded-10',
		'meta_title' => 'Tagmentase - loaded - 10',
		'meta_keywords' => '',
		'meta_description' => '',
		'modified' => '2024-09-13 14:26:44',
		'created' => '2020-12-08 16:17:54',
		'locale' => 'zho'
	),
	'Antibody' => array(
		'host' => '*****',
		'id' => null,
		'name' => null,
		'description' => null,
		'clonality' => null,
		'isotype' => null,
		'lot' => null,
		'concentration' => null,
		'reactivity' => null,
		'type' => null,
		'purity' => null,
		'classification' => null,
		'application_table' => null,
		'storage_conditions' => null,
		'storage_buffer' => null,
		'precautions' => null,
		'uniprot_acc' => null,
		'slug' => null,
		'meta_keywords' => null,
		'meta_description' => null,
		'modified' => null,
		'created' => null,
		'select_label' => null
	),
	'Slave' => array(),
	'Group' => array(
		'Group' => array(
			'id' => '331',
			'name' => 'C01070012',
			'product_id' => '3164',
			'modified' => '2020-12-08 16:19:24',
			'created' => '2020-12-08 16:19:24'
		),
		'Master' => array(
			'id' => '3164',
			'antibody_id' => null,
			'name' => 'Tagmentase (Tn5 transposase) - loaded',
			'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns">
<p>&nbsp;</p>
<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
			'label1' => 'Examples of results',
			'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => 'Product information',
			'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span> 3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span> correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions: </strong>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong> Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong> Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div>ATAC-seq package for tissue, Cat. No.&nbsp;<span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '30 μl',
			'catalog_number' => 'C01070012-30',
			'old_catalog_number' => '',
			'sf_code' => 'C01070012-143301',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '330',
			'price_USD' => '330',
			'price_GBP' => '300',
			'price_JPY' => '51695',
			'price_CNY' => '',
			'price_AUD' => '825',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => true,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'tagmentase-loaded-30',
			'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 30 | Diagenode',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
			'modified' => '2024-09-13 15:36:59',
			'created' => '2020-12-08 16:15:40'
		),
		'Product' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			)
		)
	),
	'Related' => array(
		(int) 0 => array(
			'id' => '3162',
			'antibody_id' => null,
			'name' => 'Tagmentation Buffer (2x)',
			'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode <strong>Tagmentation Buffer (2x)</strong> is the recommended reagent to perform any tagmentation reactions. It can be used in combination with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase)</a> on DNA or chromatin samples, as half of the total volume reaction like in ATAC-seq protocol.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
 var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); } 
// ]]></script>
</center></div>
</div>
<p></p>',
			'label1' => 'Examples of use',
			'info1' => '<p><span style="text-decoration: underline;">ATAC-seq experiments: </span></p>
<ul style="list-style-type: circle;">
<li>After cell lysis and nuclei isolation, the nuclei pellets can be incubated with the following mix for 1 reaction:</li>
</ul>
<table style="width: 447px;">
<tbody>
<tr>
<td style="width: 326px;">Tagmentation Buffer (2x)</td>
<td style="width: 114px; padding-left: 30px;">25 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Tagmentase loaded</td>
<td style="width: 114px; padding-left: 30px;">2.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;"><span>Digitonin 1%</span></td>
<td style="width: 114px; padding-left: 30px;">0.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Tween20 10%</td>
<td style="width: 114px; padding-left: 30px;">0.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">PBS</td>
<td style="width: 114px; padding-left: 30px;">16.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Nuclease-free water</td>
<td style="width: 114px; padding-left: 30px;">&nbsp;5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Nuclei pellet*</td>
<td style="width: 114px;"></td>
</tr>
</tbody>
</table>
<p><em>*&nbsp; The number of nuclei per reaction will depend on the ATAC-seq experimental design. Successful tagmentation with the proposed protocol has been performed on 50,000 nuclei per reaction.&nbsp;</em></p>
<ul style="list-style-type: circle;">
<li>The reaction is then incubated 30 minutes at 37&deg;C.</li>
<li>The tagmentation reaction can then be stopped by addition of 250 &micro;l of DNA Binding buffer from Diagenode MicroChIP DiaPure Columns (Cat. No. C03040001).</li>
<li>The tagmented libraries can then be purified using the MicroChIP DiaPure Columns (Cat. No. C03040001), and amplified.</li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => '',
			'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '300 µl ',
			'catalog_number' => 'C01019043',
			'old_catalog_number' => '',
			'sf_code' => 'C01019043-29421',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '90',
			'price_USD' => '100',
			'price_GBP' => '105',
			'price_JPY' => '14100',
			'price_CNY' => '',
			'price_AUD' => '250',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'tagmentation-buffer-2x',
			'meta_title' => 'Tagmentation Buffer 2x',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2023-06-20 18:19:03',
			'created' => '2020-12-08 16:00:14',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		),
		(int) 1 => array(
			'id' => '3158',
			'antibody_id' => null,
			'name' => '24 UDI for Tagmented libraries - Set I',
			'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries</strong> includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">&mu;ChIPmentation for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&amp;Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><strong>24 UDI for tagmented libraries - Set I</strong><br /> <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries -&nbsp; Set III</a><br /><br /></p>
<p><span>Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</span></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples&nbsp;</b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label1' => 'Characteristics',
			'info1' => '<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries &ndash; Set I </b>is compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&amp;Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of &micro;ChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the &micro;ChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries &ndash; Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => '',
			'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '24 UDI',
			'catalog_number' => 'C01011034',
			'old_catalog_number' => '',
			'sf_code' => 'C01011034-',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '165',
			'price_USD' => '185',
			'price_GBP' => '155',
			'price_JPY' => '25845',
			'price_CNY' => '',
			'price_AUD' => '462',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set1',
			'meta_title' => '24 unique dual indexes for tagmented libraries set 1',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2024-05-15 10:25:12',
			'created' => '2020-12-08 15:26:23',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		),
		(int) 2 => array(
			'id' => '3194',
			'antibody_id' => null,
			'name' => 'ATAC-seq kit',
			'description' => '<p><a href="https://www.diagenode.com/files/products/kits/atacseq-kit-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p><strong>ATAC-seq</strong>, Assay for<span>&nbsp;</span><strong>T</strong>ransposase-<strong>A</strong>ccessible<span>&nbsp;</span><strong>C</strong>hromatin, followed by next generation sequencing, is a key technology for genome-wide mapping of accessible chromatin. The technology is based on the use of the<span>&nbsp;</span><strong>transposase Tn5</strong><span>&nbsp;</span>which cuts exposed open chromatin and simultaneously ligates adapters for subsequent amplification and sequencing. ATAC-seq methods allow you to:</p>
<ul>
<li>&nbsp;Gain insight into gene regulation and understand open chromatin signatures</li>
<li>&nbsp;Determine nucleosome positions at single nucleotide resolution</li>
<li>&nbsp;Uncover transcription factor (TF) occupancy</li>
</ul>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Diagenode&rsquo;s<span>&nbsp;</span><b>ATAC-</b><b>seq</b><b><span>&nbsp;</span>kit<span>&nbsp;</span></b>is based on a highly validated protocol optimized for<span>&nbsp;</span><b>50,000<span>&nbsp;</span></b><b>cells</b><b><span>&nbsp;</span>per<span>&nbsp;</span></b><b>reaction</b>. The kit includes the reagents for cell lysis and nuclei extraction, tagmentation and DNA purification as well as for library amplification. The <a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">primer indexes for multiplexing</a> are not included in the kit and must be purchased separately.</p>
<h4><span style="font-weight: 400;">ATAC-seq kit features:</span></h4>
<ul>
<li><b>Cell<span>&nbsp;</span></b><b>requirement</b><b>:<span>&nbsp;</span></b><b>50,000<span>&nbsp;</span></b><b>cells /<span>&nbsp;</span></b><b>rxn</b></li>
<li><b>Robust protocol<span>&nbsp;</span></b>with<span>&nbsp;</span><b>high reproducibility<span>&nbsp;</span></b>between replicates and repetitive experiments</li>
<li><strong>Easy</strong><span>&nbsp;</span>and<span>&nbsp;</span><b>efficient DNA capture<span>&nbsp;</span></b>after the tagmentation reaction using Diagenode`s MicroChIP DiaPure columns (included)</li>
<li>Additional qPCR step to determine the number of cycles needed for library amplification: &nbsp;</li>
<ul type="&rdquo;square&rdquo;">
<li><b>Avoids<span>&nbsp;</span></b><b>over-amplification</b></li>
<li>Allows adaptation/flexibility for<span>&nbsp;</span><b>more challenging samples<span>&nbsp;</span></b>to succeed with library prep.</li>
<li>Gives<span>&nbsp;</span><strong>early indication</strong><span>&nbsp;</span>if the experiment does not work (no qPCR amplification)</li>
</ul>
</ul>
<p>Looking for ATAC-seq on tissue? Please, go to: <a href="https://www.diagenode.com/en/p/ATAC-seq-package-tissue-C01080006">ATAC-seq package for tissue</a></p>',
			'label1' => 'Method overview',
			'info1' => '<p><strong>ATAC-seq</strong>, <strong>A</strong>ssay for <strong>T</strong>ransposase-<strong>A</strong>ccessible <strong>C</strong>hromatin, followed by next generation sequencing, is a key technology to easily identify the <strong>open regions of the chromatin.</strong> The protocol consists of <strong>3 steps</strong>: <strong>nuclei preparation</strong>, <strong>tagmentation</strong> and <strong>library amplification</strong>. First, the cells undergo the lysis, ending with the crude nuclei. Then, the nuclei are incubated with a tagmentase (Tn5 transposase), which &nbsp;cuts the genomic regions associated with open chromatin and inserts the sequencing adaptors. Finally, the generated libraries are amplified and can be used for sequencing. High-throughput sequencing will then detect peaks, in open regions of the chromatin only, giving a map of the chromatin status in the whole genome of the sample.</p>
<p><img src="https://www.diagenode.com/img/product/kits/workflow-atac-seq.png" alt="ATAC-seq kit workflow" width="600px" caption="false" /></p>',
			'label2' => 'Example of results',
			'info2' => '<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig1.png" alt="library prepared with the Diagenode ATAC-seq kit " width="500px" caption="false" /></p>
<p><strong>Figure 1.</strong>Representative Bioanalyzer profile of an ATAC-seq library prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells.</p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig2.png" alt="Diagenode ATAC-seq kit " caption="false" width="951" height="148" /></p>
<p><strong>Figure 2.</strong> Main ATAC-seq alignment and peak calling statistics of 3 replicates prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells. (Mapping efficiency: Percentage of non-mitochondrial reads that mapped to the reference genome. Uniquely mapped ratio: Proportion of mapped reads that map to only one location on the reference genome (hg19). Peaks: Number of peaks (open chromatin regions) identified by MACS2 for each sample. FRiP - Fraction of reads in peaks: Percentage of reads in peaks, with respect to the number of uniquely mapped reads. Sequencing was realized in paired-end mode 50 base pairs (PE50) on an Illumina NovaSeq6000.)</p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig3a.png" alt="Assay for Transposase-Accessible Chromatin" width="500px" caption="false" /></p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig3b.png" alt="Assay for Transposase-Accessible Chromatin" width="500px" caption="false" /></p>
<p><strong>Figure 3</strong> Sequencing profiles of ATAC-seq library (3 replicates) prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells.</p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig4.png" alt=" open chromatin regions" caption="false" width="383" height="739" /></p>
<p><strong>Figure 4. </strong><br /> Heatmap around TSS of three ATAC-seq replicates prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells.</p>',
			'label3' => 'Additional solutions for ATAC-seq kit',
			'info3' => '<p><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes for tagmented libraries</a></p>
<p>Magnetic rack:<span>&nbsp;</span><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag</a><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit"><span>&nbsp;</span>0.2 ml &ndash; Cat. No. B04000001</a></p>
<p>Additional supplies (included in the kit and available separately):</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30"><span>&nbsp;</span>(Tn5 transposase)<span>&nbsp;</span></a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">loaded</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">, Cat. No. C01070012</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation</a><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x"><span>&nbsp;</span>Buffer (2x), Cat. No. C01019043</a></li>
<li><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">MicroChIP</a><span>&nbsp;</span><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">DiaPure</a><span>&nbsp;</span><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">columns</a><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">, Cat. No. C03040001</a></li>
</ul>',
			'format' => '24 rxns',
			'catalog_number' => 'C01080002',
			'old_catalog_number' => '',
			'sf_code' => 'C01080002-',
			'type' => 'RFR',
			'search_order' => '',
			'price_EUR' => '1740',
			'price_USD' => '1745',
			'price_GBP' => '1485',
			'price_JPY' => '272570',
			'price_CNY' => '',
			'price_AUD' => '4362',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'atac-seq-kit-24rxns',
			'meta_title' => 'ATAC-seq kit for open chromatin assessment C01080001 | Diagenode ',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode’s ATAC-seq kit provides a robust protocol for assessing genome-wide chromatin accessibility',
			'modified' => '2024-10-21 10:11:12',
			'created' => '2021-07-01 15:46:58',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		),
		(int) 3 => array(
			'id' => '3215',
			'antibody_id' => null,
			'name' => 'ATAC-seq package for tissue',
			'description' => '<p><a href="https://www.diagenode.com/files/products/kits/atacseq-kit-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p><b>ATAC-seq</b>, Assay for&nbsp;<b>T</b>ransposase-<b>A</b>ccessible&nbsp;<b>C</b>hromatin, followed by next generation sequencing, is a key technology for genome-wide mapping of accessible chromatin. The technology is based on the use of the&nbsp;<b>transposase Tn5</b>&nbsp;which cuts exposed open chromatin and simultaneously ligates adapters for subsequent amplification and sequencing.</p>
<p>The Diagenode&rsquo;s <b>ATAC-</b><b>seq</b><b> package for tissue </b>has been specifically developted and optimized to generate the ATAC-seq libraries from tissue samples on <b>25 to 100 mg of tissue per </b><b>reaction</b>. The protocol has been validated on many different mammalian tissues (lung, liver, brain, kidney, muscles) and different species (pork, chicken, rat, mice, horse). The package includes the reagents for complete ATAC-seq workflow, including nuclei extraction, library preparation and multiplexing.</p>
<p><strong>Content of the ATAC-seq package for tissues:</strong></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004" target="_blank" title="Tissue Nuclei Extraction for ATAC-seq">Tissue<span>&nbsp;</span>Nuclei<span>&nbsp;</span>Extraction for ATAC-seq</a><span>&nbsp;</span>&ndash; optimized protocol and reagents for highly efficient nuclei isolation from tissue, preserving the nuclei</li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq<span>&nbsp;</span>kit</a><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns"><span>&nbsp;</span></a>&ndash; generation of high quality libraries</li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24&nbsp;UDI for<span>&nbsp;</span>tagmented<span>&nbsp;</span>libraries*</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries"><span>&nbsp;</span></a>&ndash; efficient multiplexing allowing for index hopping identification and filtering.&nbsp;</li>
</ul>
<p><strong>Features:</strong></p>
<ul>
<li>Complete solution for the ATAC-seq workflow</li>
<li>Highly efficient nuclei extraction from tissue</li>
<li>Validated on many mammalian tissues</li>
<li>Compatible with Illumina sequencing platforms</li>
</ul>
<p>Looking for ATAC-seq for cells? Please go to<span>&nbsp;</span><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns">ATAC-seq kit</a>.</p>
<p><em>* For libraries multiplexing, the ATAC-seq package 24 rxns includes&nbsp; the 24 UDI for tagmented libraries kit - set I, Cat. No. C01011034. If needed, higher multiplexing is possible using other sets of <a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries" target="_blank" title="Primer indexes for tagmented libraries">Primer indexes for tagmented libraries</a>, available separately.</em></p>
<p></p>
<p><small><img src="https://icons.iconarchive.com/icons/wikipedia/flags/256/EU-European-Union-Flag-icon.png" alt="" width="45" />&nbsp; The project GENE-SWitCH leading to this application has received funding from the European Union&rsquo;s Horizon 2020 research and innovation programme under the grant agreement No 817998.<small></small></small></p>',
			'label1' => 'Method overview',
			'info1' => '<p><b>ATAC-seq</b>, <b>A</b>ssay for <b>T</b>ransposase-<b>A</b>ccessible <b>C</b>hromatin, followed by next generation sequencing, is a key technology to easily identify the <b>open regions of the chromatin.</b> The protocol consists of <b>3 steps</b>: <b>nuclei preparation</b>, <b>tagmentation</b> and <b>library amplification</b>. First, the tissue undergoes lysis, ending with the crude nuclei. Then, the nuclei are incubated with a tagmentase (Tn5 transposase), which cuts the genomic regions associated with open chromatin and inserts the sequencing adaptors. Finally, the generated libraries are amplified and can be used for sequencing. High-throughput sequencing will then detect peaks, in open regions of the chromatin only, giving a map of the chromatin status in the whole genome of the sample.</p>
<p><br /> <img src="https://www.diagenode.com/img/product/kits/workflow-atac-seq-tissue.png" alt="workflow" style="display: block; margin-left: auto; margin-right: auto;" width="600px" /></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => 'Example of results',
			'info2' => '<p>GENE-SWitCH aims to deliver new underpinning knowledge on the functional genomes of two main monogastric farm species (pig and chicken) and to enable immediate translation to the pig and poultry sectors. It is a multi-actor project that will produce new genome information to enable the characterization of genetic and epigenetic determinants of complex traits in these two species. Diagenode, as a principal participant to the project and leading the WP1, developed a new protocol to improve the preparation of ATAC-seq libraries from a variety of snap-frozen tissues. The ATAC-seq protocol combines efficient nuclei extraction procedure validated on 7 different kinds of tissues from 3 developmental stages of the two species and a robust Tagmentation protocol based on Diagenode Tn5 enzyme. The developed ATAC-seq protocol was successfully used to produce 168 ATAC-seq libraries for WP1 and 320 for WP5.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/table1-atacseq-results.png" width="400" /></center>
<p><small><strong>Table 1.</strong> List of validated tissues with Diagenode&rsquo;s ATAC-seq package for tissue (Cat. No. C01080005/6). The samples were used as part of GENE-SWitCH consortium.</small></p>
<p>A.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2a-atacseq-results.png" width="700" /></center>
<p>B.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2b-atacseq-results.png" width="700" /></center>
<p><small><strong>Figure 2.</strong> ATAC-seq library profiles generated using the ATAC-seq package for tissue (Cat. No. C01080005/6) from pork&rsquo;s liver (A) and brain (B). The samples were used as part of GENE-SWitCH consortium.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => 'Additional solutions for ATAC-seq for tissue',
			'info3' => '<p>Additional supplies (included in the kit and available separately):</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">&nbsp;(Tn5 transposase)&nbsp;loaded, Cat. No. C01070012</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation</a><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">&nbsp;Buffer (2x), Cat. No. C01019043</a></li>
<li><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">MicroChIP</a>&nbsp;<a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">DiaPure</a>&nbsp;<a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">columns, Cat. No. C03040001</a></li>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004">Tissue Nuclei Extraction for ATAC-seq, Cat. No. C0108004</a></li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq kit, Cat. No. C01080002</a></li>
</ul>
<p>Other supplies:</p>
<ul>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes for tagmented libraries</a></li>
<li><a href="https://www.diagenode.com/en/p/protease-inhibitor-mix-100-ul">Protease Inhibitor Mix 200X</a></li>
<li>Magnetic rack:&nbsp;<a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag</a><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">&nbsp;0.2 ml &ndash; Cat. No. B04000001</a></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '24 rxns',
			'catalog_number' => 'C01080006',
			'old_catalog_number' => '',
			'sf_code' => 'C01080006-',
			'type' => 'RFR',
			'search_order' => '',
			'price_EUR' => '2050',
			'price_USD' => '2050',
			'price_GBP' => '1765',
			'price_JPY' => '321130',
			'price_CNY' => '',
			'price_AUD' => '5125',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'ATAC-seq-package-tissue-C01080006',
			'meta_title' => 'ATAC-seq package for tissue|Diagenode C01080006',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode’s ATAC-seq package for tissue provides a robust protocol for assessing genome-wide chromatin accessibility on tissue samples. ',
			'modified' => '2023-04-06 11:06:44',
			'created' => '2022-03-23 16:37:31',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array([maximum depth reached])
		),
		(int) 4 => array(
			'id' => '3057',
			'antibody_id' => null,
			'name' => 'Tagmentase (Tn5 transposase) - unloaded',
			'description' => '<div class="extra-spaced"><center><img alt="Tagmentase (Tn5 transposase)" src="https://www.diagenode.com/img/banners/banner-tagmentase.jpg" caption="false" width="787" height="236" /></center></div>
<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode Tagmentase is a hyperactive Tn5 transposase with the potential to enhance epigenetic studies. Its ability to cut DNA and insert sequences of interest in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq, ChIPmentation, CHANGE-seq and other. The enzyme is not loaded with DNA oligos, providing flexibility of application. To ensure optimal results the concentration may be adjusted with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> (Cat. No. C01070011), available separately.</p>
<p><a href="https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf" target="_blank">Protocol for transposome assembly</a></p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) you may also need:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for loaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) - loaded</a>.</p>',
			'label1' => 'Quality control',
			'info1' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><img alt="Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1a.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="653" height="282" /></p>
<p><img alt="Tagmentase Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1b.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="645" height="278" /></p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 1: Efficient fragmentation of the lambda DNA after incubation with the Tagmentase</strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with diluted Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). Profiles show the size of lambda DNA before (A) and after treatment with Tagmentase (B).</p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns"><center><img alt="Tn5 transposase perfect for NGS" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure2.jpg" width="754" height="492" /></center></div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 2: Fragmentation efficiency depending on the amount of Tagmentase </strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The Tagmentase was previously diluted with the Tagmentase Dilution Buffer (Cat. No.) at &frac14; and 1/16 dilutions. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). The migration of the samples shows variations of the size distribution according to the amount of Tagmentase used for the reaction.</p>
</div>
</div>',
			'label2' => 'Product information',
			'info2' => '<p><strong>Tagmentase (Tn5 transposase) - unloaded</strong></p>
<div><span style="font-family: inherit;">Protein Molecular weight: 53.3 kDa</span></div>
<p>Expressed: in Escherichia coli</p>
<p><strong>Product description:</strong> Diagenode Tagmentase &ndash; unloaded is a hyperactive Tn5 transposase. The enzyme catalyzes &ldquo;cut and paste&rdquo; tagmentation reaction and can be used to insert any target DNA in vitro.</p>
<p><strong>Storage conditions:</strong> Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer: </strong>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>The enzyme should be loaded with appropriate oligonucleotides prior to use. An efficient transposition require that insert DNA have a specific 19-bp transposase recognition sequence (Mosaic End or ME sequence) at each of its ends. The transposome assembly protocol can be found at https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications: </strong>Tagmentase (Tn5 transposase) &ndash; unloaded can be used in a variety of applications including transgenic experiments, barcoding and library construction for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '10 µl',
			'catalog_number' => 'C01070010-10',
			'old_catalog_number' => '',
			'sf_code' => 'C01070010-19650',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '355',
			'price_USD' => '355',
			'price_GBP' => '320',
			'price_JPY' => '55610',
			'price_CNY' => '0',
			'price_AUD' => '888',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'tagmentase',
			'meta_title' => 'Tagmentase (Tn5 transposase) -unloaded | Diagenode',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. The enzyme is not loaded with DNA oligos, providing flexibility of application.',
			'modified' => '2024-09-13 15:48:15',
			'created' => '2020-03-24 17:33:04',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		)
	),
	'Application' => array(),
	'Category' => array(
		(int) 0 => array(
			'id' => '3',
			'position' => '4',
			'parent_id' => null,
			'name' => 'Kits',
			'description' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p style="text-align: justify;">Diagenode&rsquo;s epigenetic reagents include:</p>
<ul>
<li style="text-align: justify;"><strong>DNA methylation kits and antibodies</strong> - Validated&nbsp;NGS-compatible kits for MeDIP, MBD pull-down, whole genome bisulfite sequencing, and reduced representation bisulfite sequencing. Official provider for the original clone for 5-mC 33D3.</li>
<li style="text-align: justify;"><strong>ChIP and ChIP-seq kits for industry-leading specificity and sensitivity</strong> - MicroChIP/MicroPlex Kit for ChIP-seq with only 10,000 cells and the iDeal ChIP-seq Kits optimized for both transcription factors and histones. Our kits feature full reagents for ChIP-seq including control primers, control antibodies, magnetics beads, and purification reagents.</li>
<li style="text-align: justify;"><strong>Library preparation kits</strong> tailored for your specific requirements. The MicroPlex Library Preparation Kit simplifies library preparation requiring only 3 simple steps and allowing inputs of only 50 pg.&nbsp;</li>
</ul>
</div>
</div>',
			'no_promo' => false,
			'in_menu' => false,
			'online' => true,
			'tabular' => false,
			'hide' => false,
			'all_format' => false,
			'is_antibody' => false,
			'slug' => 'kits',
			'cookies_tag_id' => null,
			'meta_keywords' => 'DNA methylation Kits,ChIP and ChIP-seq kits,Library preparation kits,MicroChIP/MicroPlex Kit,iDeal Library Preparation Kit',
			'meta_description' => 'Diagenode provides Isotype controls for Methylated DNA Immunoprecipitation',
			'meta_title' => 'Isotype controls for Methylated DNA Immunoprecipitation | Diagenode',
			'modified' => '2019-07-03 10:48:00',
			'created' => '2014-11-13 22:28:36',
			'ProductsCategory' => array(
				[maximum depth reached]
			),
			'CookiesTag' => array([maximum depth reached])
		)
	),
	'Document' => array(
		(int) 0 => array(
			'id' => '1116',
			'name' => 'Datasheet Tagmentase loaded C01070012',
			'description' => '',
			'image_id' => null,
			'type' => 'Datasheet',
			'url' => 'files/products/kits/Datasheet_Tagmentase_loaded_C01070012.pdf',
			'slug' => 'tagmentase-loaded-30-datasheet',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2020-12-10 17:04:06',
			'created' => '2020-12-10 17:04:06',
			'ProductsDocument' => array(
				[maximum depth reached]
			)
		)
	),
	'Feature' => array(),
	'Image' => array(
		(int) 0 => array(
			'id' => '1829',
			'name' => 'https://www.diagenode.com/img/product/kits/tag-loaded.png',
			'alt' => 'Tubes',
			'modified' => '2024-03-28 17:30:39',
			'created' => '2024-03-28 17:30:39',
			'ProductsImage' => array(
				[maximum depth reached]
			)
		)
	),
	'Promotion' => array(),
	'Protocol' => array(),
	'Publication' => array(
		(int) 0 => array(
			'id' => '5002',
			'name' => 'HIRA protects telomeres against R-loop-induced instability in ALT cancer cells',
			'authors' => 'Michelle Lee Lynskey et al.',
			'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HIRA establishes greater telomeric chromatin accessibility after ATRX-DAXX loss</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">Deposition of new H3.3 by HIRA-UBN restricts telomeric ssDNA and TERRA R-loops</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">Unresolved TERRA R-loops block new H3.3 deposition by HIRA-UBN</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">CHK1 phosphorylation of H3.3 is critical to prevent ssDNA and TERRA R-loop buildup</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">Inactivating mutations in chromatin modifiers, like the &alpha;-thalassemia/mental retardation, X-linked (ATRX)-death domain-associated protein (DAXX) chromatin remodeling/histone H3.3 deposition complex, drive the cancer-specific alternative lengthening of telomeres (ALT) pathway. Prior studies revealed that HIRA, another histone H3.3 chaperone, compensates for ATRX-DAXX loss at telomeres to sustain ALT cancer cell survival. How HIRA rescues telomeres from the consequences of ATRX-DAXX deficiency remains unclear. Here, using an assay for transposase-accessible chromatin using sequencing (ATAC-seq) and cleavage under targets and release using nuclease (CUT&amp;RUN), we establish that HIRA-mediated deposition of new H3.3 maintains telomeric chromatin accessibility to prevent the detrimental accumulation of nucleosome-free single-stranded DNA (ssDNA) in ATRX-DAXX-deficient ALT cells. We show that the HIRA-UBN1/UBN2 complex deposits new H3.3 to prevent TERRA R-loop buildup and transcription-replication conflicts (TRCs) at telomeres. Furthermore, HIRA-mediated H3.3 incorporation into telomeric chromatin links productive ALT to the phosphorylation of serine 31, an H3.3-specific amino acid, by Chk1. Therefore, we identify a critical role for HIRA-mediated H3.3 deposition that ensures the survival of ATRX-DAXX-deficient ALT cancer cells.</div>
</section>
<section id="graphical-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name"></h2>
</section>',
			'date' => '2024-11-26',
			'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01315-9',
			'doi' => '10.1016/j.celrep.2024.114964',
			'modified' => '2024-11-12 09:41:40',
			'created' => '2024-11-12 09:41:40',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 1 => array(
			'id' => '4996',
			'name' => 'ARMC5 selectively degrades SCAP-free SREBF1 and is essential for fatty acid desaturation in adipocytes',
			'authors' => 'Akifumi Uota et al.',
			'description' => '<p><span>SREBF1 plays the central role in lipid metabolism. It has been known that full-length SREBF1 that did not associate with SCAP (SCAP-free SREBF1) is actively degraded, but its molecular mechanism and its biological meaning remain unclear. ARMC5-CUL3 complex was recently identified as E3 ubiquitin ligase of full-length SREBF. Although ARMC5 was involved in SREBF pathway in adrenocortical cells, the role of ARMC5 in adipocytes has not been investigated. In this study, adipocyte-specific&nbsp;</span><em>Armc5</em><span><span>&nbsp;</span>knockout mice were generated. In the white adipose tissue (WAT) of these mice, all the stearoyl-CoA desaturase (</span><em>Scd</em><span>) were drastically downregulated. Consistently, unsaturated fatty acids were decreased and saturated fatty acids were increased. The protein amount of full-length SREBF1 were increased, but ATAC-Seq peaks at the SREBF1-binding sites were markedly diminished around the<span>&nbsp;</span></span><em>Scd1</em><span><span>&nbsp;</span>locus in the WAT of<span>&nbsp;</span></span><em>Armc5</em><span><span>&nbsp;</span>knockout mice. Armc5-deficient 3T3-L1 adipocytes also exhibited downregulation of<span>&nbsp;</span></span><em>Scd</em><span>. Mechanistically, disruption of<span>&nbsp;</span></span><em>Armc5</em><span><span>&nbsp;</span>restored decreased full-length SREBF1 in CHO cells deficient for<span>&nbsp;</span></span><em>Scap</em><span>. Overexpression of<span>&nbsp;</span></span><em>Scap</em><span><span>&nbsp;</span>inhibited ARMC5-mediated degradation of full-length SREBF1, and overexpression of<span>&nbsp;</span></span><em>Armc5</em><span><span>&nbsp;</span>increased nuclear SREBF1/full-length SREBF1 ratio and SREBF1 transcriptional activity in the presence of exogenous SCAP. These results demonstrated that ARMC5 selectively removes SCAP-free SREBF1 and stimulates SCAP-mediated SREBF1 processing, hence is essential for fatty acid desaturation<span>&nbsp;</span></span><em>in vivo</em><span>.</span></p>',
			'date' => '2024-11-02',
			'pmid' => 'https://www.sciencedirect.com/science/article/pii/S0021925824024554',
			'doi' => 'https://doi.org/10.1016/j.jbc.2024.107953',
			'modified' => '2024-11-05 08:33:28',
			'created' => '2024-11-05 08:33:28',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 2 => array(
			'id' => '4985',
			'name' => 'HNF1β bookmarking involves Topoisomerase 1 activation and DNA topology relaxation in mitotic chromatin',
			'authors' => 'Alessia Bagattin et al.',
			'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HNF1&beta; mitotic site binding is preserved with a specific methanol/formaldehyde ChIP</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">BTBD2, an HNF1&beta; partner, mediates mitosis-specific interaction with TOP1</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">HNF1&beta; recruits TOP1 and induces DNA relaxation around bookmarked HNF1&beta; sites</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">An HNF1&beta; mutation, found in MODY patients, disrupts the interaction with TOP1</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">HNF1&beta; (<i>HNF1B</i>) is a transcription factor frequently mutated in patients with developmental renal disease. It binds to mitotic chromatin and reactivates gene expression after mitosis, a phenomenon referred to as bookmarking. Using a crosslinking method that circumvents the artifacts of formaldehyde, we demonstrate that&nbsp;HNF1&beta; remains associated with chromatin in a sequence-specific way in both interphase and mitosis. We identify an HNF1&beta;-interacting protein, BTBD2, that enables the interaction and activation of Topoisomerase 1 (TOP1) exclusively during mitosis. Our study identifies a shared microhomology domain between HNF1&beta; and TOP1, where a mutation, found in &ldquo;maturity onset diabetes of the young&rdquo; patients, disrupts their interaction. Importantly, HNF1&beta; recruits TOP1 and induces DNA relaxation around HNF1&beta; mitotic chromatin sites, elucidating its crucial role in chromatin remodeling and gene reactivation after mitotic exit. These findings shed light on how HNF1&beta; reactivates target gene expression after mitosis, providing insights into its crucial role in maintenance of cellular identity.</div>
</section>',
			'date' => '2024-10-08',
			'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01156-2',
			'doi' => '10.1016/j.celrep.2024.114805',
			'modified' => '2024-10-14 09:04:44',
			'created' => '2024-10-14 09:04:44',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 3 => array(
			'id' => '4969',
			'name' => 'Nuclear lamin A/C phosphorylation by loss of androgen receptor leads to cancer-associated fibroblast activation',
			'authors' => 'Ghosh S. et al.',
			'description' => '<p><span>Alterations in nuclear structure and function are hallmarks of cancer cells. Little is known about these changes in Cancer-Associated Fibroblasts (CAFs), crucial components of the&nbsp;tumor microenvironment. Loss of the androgen receptor (AR) in human dermal fibroblasts (HDFs), which triggers early steps of CAF activation, leads to nuclear membrane changes and micronuclei formation, independent of cellular senescence. Similar changes occur in established CAFs and are reversed by restoring AR activity. AR associates with nuclear lamin A/C, and its loss causes lamin A/C nucleoplasmic redistribution. AR serves as a bridge between lamin A/C and the protein phosphatase PPP1. Loss of AR decreases lamin-PPP1 association and increases lamin A/C phosphorylation at Ser 301, a characteristic of CAFs. Phosphorylated lamin A/C at Ser 301 binds to the regulatory region of CAF effector genes of the myofibroblast subtype. Expression of a lamin A/C Ser301 phosphomimetic mutant alone can transform normal fibroblasts into tumor-promoting CAFs.</span></p>',
			'date' => '2024-09-12',
			'pmid' => 'https://www.nature.com/articles/s41467-024-52344-z',
			'doi' => 'https://doi.org/10.1038/s41467-024-52344-z',
			'modified' => '2024-09-16 09:43:31',
			'created' => '2024-09-16 09:43:31',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 4 => array(
			'id' => '4970',
			'name' => 'A critical role for HNF4α in polymicrobial sepsis-associated metabolic reprogramming and death',
			'authors' => 'van Dender C. et al. ',
			'description' => '<p><span>In sepsis, limited food intake and increased energy expenditure induce a starvation response, which is compromised by a quick decline in the expression of hepatic PPAR&alpha;, a transcription factor essential in intracellular catabolism of free fatty acids. The mechanism upstream of this PPAR&alpha; downregulation is unknown. We found that sepsis causes a progressive hepatic loss-of-function of HNF4&alpha;, which has a strong impact on the expression of several important nuclear receptors, including PPAR&alpha;. HNF4&alpha; depletion in hepatocytes dramatically increases sepsis lethality, steatosis, and organ damage and prevents an adequate response to IL6, which is critical for liver regeneration and survival. An HNF4&alpha; agonist protects against sepsis at all levels, irrespectively of bacterial loads, suggesting HNF4&alpha; is crucial in tolerance to sepsis. In conclusion, hepatic HNF4&alpha; activity is decreased during sepsis, causing PPAR&alpha; downregulation, metabolic problems, and a disturbed IL6-mediated acute phase response. The findings provide new insights and therapeutic options in sepsis.</span></p>',
			'date' => '2024-09-11',
			'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/39261648/',
			'doi' => '10.1038/s44321-024-00130-1',
			'modified' => '2024-09-16 09:49:27',
			'created' => '2024-09-16 09:49:27',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 5 => array(
			'id' => '4926',
			'name' => 'High-throughput sequencing of insect specimens with sub-optimal DNA preservation using a practical, plate-based Illumina-compatible Tn5 transposase library preparation method',
			'authors' => 'Cobb L. et all.',
			'description' => '<p><span>Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, which often requires substantial DNA input amounts. Here, we use a practical Tn5 transposase tagmentation-based library preparation method optimised for 96-well plates and low yield DNA extracts from insect legs that were stored under sub-optimal conditions for DNA preservation. The samples were kept in field vehicles for extended periods of time, before long-term storage in ethanol in the freezer, or dry at room temperature. By reducing DNA input to 6ng, more samples with sub-optimal DNA yields could be processed. We matched this low DNA input with a 6-fold dilution of a commercially available tagmentation enzyme, significantly reducing library preparation costs. Costs and workload were further suppressed by direct post-amplification pooling of individual libraries. We generated medium coverage (&gt;3-fold) genomes for 88 out of 90 specimens, with an average of approximately 10-fold coverage. While samples stored in ethanol yielded significantly less DNA compared to those which were stored dry, these samples had superior sequencing statistics, with longer sequencing reads and higher rates of endogenous DNA. Furthermore, we find that the efficiency of tagmentation-based library preparation can be improved by a thorough post-amplification bead clean-up which selects against both short and large DNA fragments. By opening opportunities for the use of sub-optimally preserved, low yield DNA extracts, we broaden the scope of whole genome studies of insect specimens. We therefore expect these results and this protocol to be valuable for a range of applications in the field of entomology.</span></p>',
			'date' => '2024-03-22',
			'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38517905/',
			'doi' => '10.1371/journal.pone.0300865',
			'modified' => '2024-03-25 11:15:06',
			'created' => '2024-03-25 11:15:06',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 6 => array(
			'id' => '4923',
			'name' => 'On the identification of differentially-active transcription factors from ATAC-seq data',
			'authors' => 'Gerbaldo F. et al.',
			'description' => '<p><span>ATAC-seq has emerged as a rich epigenome profiling technique, and is commonly used to identify Transcription Factors (TFs) underlying given phenomena. A number of methods can be used to identify differentially-active TFs through the accessibility of their DNA-binding motif, however little is known on the best approaches for doing so. Here we benchmark several such methods using a combination of curated datasets with various forms of short-term perturbations on known TFs, as well as semi-simulations. We include both methods specifically designed for this type of data as well as some that can be repurposed for it. We also investigate variations to these methods, and identify three particularly promising approaches (chromVAR-limma with critical adjustments, monaLisa and a combination of GC smooth quantile normalization and multivariate modeling). We further investigate the specific use of nucleosome-free fragments, the combination of top methods, and the impact of technical variation. Finally, we illustrate the use of the top methods on a novel dataset to characterize the impact on DNA accessibility of TRAnscription Factor TArgeting Chimeras (TRAFTAC), which can deplete TFs &ndash; in our case NFkB &ndash; at the protein level.</span></p>',
			'date' => '2024-03-10',
			'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.03.06.583825v2',
			'doi' => 'https://doi.org/10.1101/2024.03.06.583825',
			'modified' => '2024-03-13 17:04:33',
			'created' => '2024-03-13 17:04:33',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 7 => array(
			'id' => '4918',
			'name' => 'Cellular reprogramming in vivo initiated by SOX4 pioneer factor activity',
			'authors' => 'Katsuda T.',
			'description' => '<p><span>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate &ldquo;reprogramming&rdquo; by opening new chromatin sites for expression that can attract transcription factors from the starting cell&rsquo;s enhancers. Here we report that SOX4 is sufficient to initiate hepatobiliary metaplasia in the adult mouse liver, closely mimicking metaplasia initiated by toxic damage to the liver. In lineage-traced cells, we assessed the timing of SOX4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, SOX4 directly binds to and closes hepatocyte regulatory sequences via an overlapping motif with HNF4A, a hepatocyte master regulatory transcription factor. Subsequently, SOX4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</span></p>',
			'date' => '2024-02-26',
			'pmid' => 'https://www.nature.com/articles/s41467-024-45939-z',
			'doi' => 'https://doi.org/10.1038/s41467-024-45939-z',
			'modified' => '2024-02-29 11:59:10',
			'created' => '2024-02-29 11:59:10',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 8 => array(
			'id' => '4889',
			'name' => 'The ncBAF complex regulates transcription in AML through H3K27ac sensing by BRD9',
			'authors' => 'Klein D.C. et al. ',
			'description' => '<p><span>The non-canonical BAF complex (ncBAF) subunit BRD9 is essential for acute myeloid leukemia (AML) cell viability but has an unclear role in leukemogenesis. Because BRD9 is required for ncBAF complex assembly through its DUF3512 domain, precise bromodomain inhibition is necessary to parse the role of BRD9 as a transcriptional regulator from that of a scaffolding protein. To understand the role of BRD9 bromodomain function in regulating AML, we selected a panel of five AML cell lines with distinct driver mutations, disease classifications, and genomic aberrations and subjected these cells to short-term BRD9 bromodomain inhibition. We examined the bromodomain-dependent growth of these cell lines, identifying a dependency in AML cell lines but not HEK293T cells. To define a mechanism through which BRD9 maintains AML cell survival, we examined nascent transcription, chromatin accessibility, and ncBAF complex binding genome-wide after bromodomain inhibition. We identified extensive regulation of transcription by BRD9 bromodomain activity, including repression of myeloid maturation factors and tumor suppressor genes, while standard AML chemotherapy targets were repressed by inhibition of the BRD9 bromodomain. BRD9 bromodomain activity maintained accessible chromatin at both gene promoters and gene-distal putative enhancer regions, in a manner that qualitatively correlated with enrichment of BRD9 binding. Furthermore, we identified reduced chromatin accessibility at GATA, ETS, and AP-1 motifs and increased chromatin accessibility at SNAIL-, HIC-, and TP53-recognized motifs after BRD9 inhibition. These data suggest a role for BRD9 in regulating AML cell differentiation through modulation of accessibility at hematopoietic transcription factor binding sites.</span></p>',
			'date' => '2023-12-21',
			'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38126767/',
			'doi' => '10.1158/2767-9764.CRC-23-0382',
			'modified' => '2024-01-02 11:07:14',
			'created' => '2024-01-02 11:07:14',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 9 => array(
			'id' => '4878',
			'name' => 'ARID1A governs the silencing of sex-linked transcription during male meiosis in the mouse',
			'authors' => 'Menon D.U. et al.',
			'description' => '<p><span>We present evidence implicating the BAF (BRG1/BRM Associated Factor) chromatin remodeler in meiotic sex chromosome inactivation (MSCI). By immunofluorescence (IF), the putative BAF DNA binding subunit, ARID1A (AT-rich Interaction Domain 1a), appeared enriched on the male sex chromosomes during diplonema of meiosis I. The germ cell-specific depletion of ARID1A resulted in a pachynema arrest and failure to repress sex-linked genes, indicating a defective MSCI. Consistent with this defect, mutant sex chromosomes displayed an abnormal presence of elongating RNA polymerase II coupled with an overall increase in chromatin accessibility detectable by ATAC-seq. By investigating potential mechanisms underlying these anomalies, we identified a role for ARID1A in promoting the preferential enrichment of the histone variant, H3.3, on the sex chromosomes, a known hallmark of MSCI. Without ARID1A, the sex chromosomes appeared depleted of H3.3 at levels resembling autosomes. Higher resolution analyses by CUT&amp;RUN revealed shifts in sex-linked H3.3 associations from discrete intergenic sites and broader gene-body domains to promoters in response to the loss of ARID1A. Several sex-linked sites displayed ectopic H3.3 occupancy that did not co-localize with DMC1 (DNA Meiotic Recombinase 1). This observation suggests a requirement for ARID1A in DMC1 localization to the asynapsed sex chromatids. We conclude that ARID1A-directed H3.3 localization influences meiotic sex chromosome gene regulation and DNA repair.</span></p>',
			'date' => '2023-09-28',
			'pmid' => 'https://www.biorxiv.org/content/10.1101/2023.05.25.542290v2.abstract',
			'doi' => 'https://doi.org/10.1101/2023.05.25.542290',
			'modified' => '2023-11-10 14:53:09',
			'created' => '2023-11-10 14:53:09',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 10 => array(
			'id' => '4825',
			'name' => 'Zfp296 knockout enhances chromatin accessibility and induces a uniquestate of pluripotency in embryonic stem cells.',
			'authors' => 'Miyazaki  S. et al.',
			'description' => '<p>The Zfp296 gene encodes a zinc finger-type protein. Its expression is high in mouse embryonic stem cells (ESCs) but rapidly decreases following differentiation. Zfp296-knockout (KO) ESCs grew as flat colonies, which were reverted to rounded colonies by exogenous expression of Zfp296. KO ESCs could not form teratomas when transplanted into mice but could efficiently contribute to germline-competent chimeric mice following blastocyst injection. Transcriptome analysis revealed that Zfp296 deficiency up- and down-regulates a distinct group of genes, among which Dppa3, Otx2, and Pou3f1 were markedly downregulated. Chromatin immunoprecipitation sequencing demonstrated that ZFP296 binding is predominantly seen in the vicinity of the transcription start sites (TSSs) of a number of genes, and ZFP296 was suggested to negatively regulate transcription. Consistently, chromatin accessibility assay clearly showed that ZFP296 binding reduces the accessibility of the TSS regions of target genes. Zfp296-KO ESCs showed increased histone H3K9 di- and trimethylation. Co-immunoprecipitation analyses revealed interaction of ZFP296 with G9a and GLP. These results show that ZFP296 plays essential roles in maintaining the global epigenetic state of ESCs through multiple mechanisms including activation of Dppa3, attenuation of chromatin accessibility, and repression of H3K9 methylation, but that Zfp296-KO ESCs retain a unique state of pluripotency while lacking the teratoma-forming ability.</p>',
			'date' => '2023-07-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37488353',
			'doi' => '10.1038/s42003-023-05148-8',
			'modified' => '2023-08-01 13:30:58',
			'created' => '2023-08-01 15:59:38',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 11 => array(
			'id' => '4817',
			'name' => 'YAP/BRD4-controlled ROR1 promotes tumor-initiating cells andhyperproliferation in pancreatic cancer.',
			'authors' => 'Yamazaki  M. et al.',
			'description' => '<p><span>Tumor-initiating cells are major drivers of chemoresistance and attractive targets for cancer therapy, however, their identity in human pancreatic ductal adenocarcinoma (PDAC) and the key molecules underlying their traits remain poorly understood. Here, we show that a cellular subpopulation with partial epithelial-mesenchymal transition (EMT)-like signature marked by high expression of receptor tyrosine kinase-like orphan receptor 1 (ROR1) is the origin of heterogeneous tumor cells in PDAC. We demonstrate that ROR1 depletion suppresses tumor growth, recurrence after chemotherapy, and metastasis. Mechanistically, ROR1 induces the expression of Aurora kinase B (AURKB) by activating E2F through c-Myc to enhance PDAC proliferation. Furthermore, epigenomic analyses reveal that ROR1 is transcriptionally dependent on YAP/BRD4 binding at the enhancer region, and targeting this pathway reduces ROR1 expression and prevents PDAC growth. Collectively, our findings reveal a critical role for ROR1high cells as tumor-initiating cells and the functional importance of ROR1 in PDAC progression, thereby highlighting its therapeutic targetability.</span></p>',
			'date' => '2023-04-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37096681',
			'doi' => '10.15252/embj.2022112614',
			'modified' => '2023-06-15 10:06:12',
			'created' => '2023-06-13 21:11:31',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 12 => array(
			'id' => '4757',
			'name' => 'Analyzing genomic and epigenetic profiles in single cells by hybridtransposase (scGET-seq).',
			'authors' => 'Cittaro  D. et al.',
			'description' => '<p>scGET-seq simultaneously profiles euchromatin and heterochromatin. scGET-seq exploits the concurrent action of transposase Tn5 and its hybrid form TnH, which targets H3K9me3 domains. Here we present a step-by-step protocol to profile single cells by scGET-seq using a 10&Atilde;&mdash; Chromium Controller. We describe steps for transposomes preparation and validation. We detail nuclei preparation and transposition, followed by encapsulation, library preparation, sequencing, and data analysis. For complete details on the use and execution of this protocol, please refer to Tedesco et&Acirc;&nbsp;al. (2022) and de Pretis and Cittaro (2022)..</p>',
			'date' => '2023-03-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37000619',
			'doi' => '10.1016/j.xpro.2023.102176',
			'modified' => '2023-04-17 09:04:55',
			'created' => '2023-04-14 13:41:22',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 13 => array(
			'id' => '4742',
			'name' => 'A neurodevelopmental epigenetic programme mediated bySMARCD3-DAB1-Reelin signalling is hijacked to promote medulloblastomametastasis.',
			'authors' => 'Zou  Han et al.',
			'description' => '<p>How abnormal neurodevelopment relates to the tumour aggressiveness of medulloblastoma (MB), the most common type of embryonal tumour, remains elusive. Here we uncover a neurodevelopmental epigenomic programme that is hijacked to induce MB metastatic dissemination. Unsupervised analyses of integrated publicly available datasets with our newly generated data reveal that SMARCD3 (also known as BAF60C) regulates Disabled&acirc;&euro;&permil;1 (DAB1)-mediated Reelin signalling in Purkinje cell migration and MB metastasis by orchestrating cis-regulatory elements at the DAB1 locus. We further identify that a core set of transcription factors, enhancer of zeste homologue&acirc;&euro;&permil;2 (EZH2) and nuclear factor&acirc;&euro;&permil;I&acirc;&euro;&permil;X (NFIX), coordinates with the cis-regulatory elements at the SMARCD3 locus to form a chromatin hub to control SMARCD3 expression in the developing cerebellum and in metastatic MB. Increased SMARCD3 expression activates Reelin-DAB1-mediated Src kinase signalling, which results in a MB response to Src inhibition. These data deepen our understanding of how neurodevelopmental programming influences disease progression and provide a potential therapeutic option for patients with MB.</p>',
			'date' => '2023-02-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/36849558',
			'doi' => '10.1038/s41556-023-01093-0',
			'modified' => '2023-03-14 09:41:24',
			'created' => '2023-03-02 17:27:08',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 14 => array(
			'id' => '4568',
			'name' => 'Physiological reprogramming in vivo mediated by Sox4 pioneer factoractivity',
			'authors' => 'Katsuda  T. et al.',
			'description' => '<p>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate &ldquo;reprogramming&rdquo; by opening new chromatin sites for expression that can attract transcription factors from the starting cell&rsquo;s enhancers. Here we report that Sox4 is sufficient to initiate hepatobiliary metaplasia in the adult liver. In lineage-traced cells, we assessed the timing of Sox4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, Sox4 directly binds to and closes hepatocyte regulatory sequences via a motif it overlaps with Hnf4a, a hepatocyte master regulator. Subsequently, Sox4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</p>',
			'date' => '2023-01-01',
			'pmid' => 'https://doi.org/10.1101%2F2023.02.14.528556',
			'doi' => '10.1101/2023.02.14.528556',
			'modified' => '2023-04-11 10:26:02',
			'created' => '2023-02-21 09:59:46',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 15 => array(
			'id' => '4660',
			'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
			'authors' => 'Zolotarev  Nikolay et al.',
			'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to na&iuml;ve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
			'date' => '2022-11-01',
			'pmid' => 'https://doi.org/10.1073%2Fpnas',
			'doi' => '10.1073/pnas.2210595119',
			'modified' => '2023-03-07 09:07:41',
			'created' => '2023-02-21 09:59:46',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		)
	),
	'Testimonial' => array(
		(int) 0 => array(
			'id' => '82',
			'name' => 'Tagmentase',
			'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
			'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
			'featured' => true,
			'slug' => 'testimonial-tagmentase',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2023-02-08 09:40:13',
			'created' => '2023-02-08 09:37:00',
			'ProductsTestimonial' => array(
				[maximum depth reached]
			)
		)
	),
	'Area' => array(),
	'SafetySheet' => array(
		(int) 0 => array(
			'id' => '2128',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS US en',
			'language' => 'en',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-US-en-GHS_1_0.pdf',
			'countries' => 'US',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 1 => array(
			'id' => '2126',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS GB en',
			'language' => 'en',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-GB-en-GHS_1_0.pdf',
			'countries' => 'GB',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 2 => array(
			'id' => '2121',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS BE fr',
			'language' => 'fr',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-BE-fr-GHS_1_0.pdf',
			'countries' => 'BE',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 3 => array(
			'id' => '2125',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS FR fr',
			'language' => 'fr',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-FR-fr-GHS_1_0.pdf',
			'countries' => 'FR',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 4 => array(
			'id' => '2124',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS ES es',
			'language' => 'es',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-ES-es-GHS_1_0.pdf',
			'countries' => 'ES',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 5 => array(
			'id' => '2123',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS DE de',
			'language' => 'de',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-DE-de-GHS_1_0.pdf',
			'countries' => 'DE',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 6 => array(
			'id' => '2127',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS JP ja',
			'language' => 'ja',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-JP-ja-GHS_2_0.pdf',
			'countries' => 'JP',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 7 => array(
			'id' => '2122',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS BE nl',
			'language' => 'nl',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-BE-nl-GHS_1_0.pdf',
			'countries' => 'BE',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		)
	)
)
$meta_canonical = 'https://www.diagenode.com/cn/p/tagmentase-loaded-30'
$country = 'US'
$countries_allowed = array(
	(int) 0 => 'CA',
	(int) 1 => 'US',
	(int) 2 => 'IE',
	(int) 3 => 'GB',
	(int) 4 => 'DK',
	(int) 5 => 'NO',
	(int) 6 => 'SE',
	(int) 7 => 'FI',
	(int) 8 => 'NL',
	(int) 9 => 'BE',
	(int) 10 => 'LU',
	(int) 11 => 'FR',
	(int) 12 => 'DE',
	(int) 13 => 'CH',
	(int) 14 => 'AT',
	(int) 15 => 'ES',
	(int) 16 => 'IT',
	(int) 17 => 'PT'
)
$outsource = true
$other_formats = array(
	(int) 0 => array(
		'id' => '3164',
		'antibody_id' => null,
		'name' => 'Tagmentase (Tn5 transposase) - loaded',
		'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns">
<p>&nbsp;</p>
<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
		'label1' => 'Examples of results',
		'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label2' => 'Product information',
		'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span> 3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span> correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions: </strong>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong> Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong> Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div>ATAC-seq package for tissue, Cat. No.&nbsp;<span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label3' => '',
		'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'format' => '30 μl',
		'catalog_number' => 'C01070012-30',
		'old_catalog_number' => '',
		'sf_code' => 'C01070012-143301',
		'type' => 'FRE',
		'search_order' => '',
		'price_EUR' => '330',
		'price_USD' => '330',
		'price_GBP' => '300',
		'price_JPY' => '51695',
		'price_CNY' => '',
		'price_AUD' => '825',
		'country' => 'ALL',
		'except_countries' => 'None',
		'quote' => false,
		'in_stock' => false,
		'featured' => true,
		'no_promo' => false,
		'online' => true,
		'master' => true,
		'last_datasheet_update' => '',
		'slug' => 'tagmentase-loaded-30',
		'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 30 | Diagenode',
		'meta_keywords' => '',
		'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
		'modified' => '2024-09-13 15:36:59',
		'created' => '2020-12-08 16:15:40'
	),
	(int) 1 => array(
		'id' => '3205',
		'antibody_id' => null,
		'name' => 'Tagmentase (Tn5 transposase) - loaded',
		'description' => '<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
		'label1' => 'Examples of results',
		'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label2' => 'Product information',
		'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span><span>&nbsp;</span>3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span><span>&nbsp;</span>correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions:</strong><span>&nbsp;</span>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong><span>&nbsp;</span>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage:&nbsp;</strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong><span>&nbsp;</span>Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div><span>ATAC-seq package for tissue, Cat. No.&nbsp;</span><span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label3' => '',
		'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'format' => '200 μl',
		'catalog_number' => 'C01070012-200',
		'old_catalog_number' => '',
		'sf_code' => 'C01070012-93190',
		'type' => 'FRE',
		'search_order' => '',
		'price_EUR' => '2090',
		'price_USD' => '2090',
		'price_GBP' => '1800',
		'price_JPY' => '327400',
		'price_CNY' => '0',
		'price_AUD' => '5225',
		'country' => 'ALL',
		'except_countries' => 'None',
		'quote' => true,
		'in_stock' => false,
		'featured' => false,
		'no_promo' => false,
		'online' => true,
		'master' => false,
		'last_datasheet_update' => '',
		'slug' => 'tagmentase-loaded-200',
		'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Diagenode',
		'meta_keywords' => '',
		'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
		'modified' => '2024-09-13 15:37:53',
		'created' => '2021-10-21 11:35:59',
		'ProductsGroup' => array(
			'id' => '400',
			'product_id' => '3205',
			'group_id' => '331'
		)
	)
)
$pro = array(
	'id' => '3205',
	'antibody_id' => null,
	'name' => 'Tagmentase (Tn5 transposase) - loaded',
	'description' => '<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
	'label1' => 'Examples of results',
	'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label2' => 'Product information',
	'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span><span>&nbsp;</span>3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span><span>&nbsp;</span>correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions:</strong><span>&nbsp;</span>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong><span>&nbsp;</span>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage:&nbsp;</strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong><span>&nbsp;</span>Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div><span>ATAC-seq package for tissue, Cat. No.&nbsp;</span><span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label3' => '',
	'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'format' => '200 μl',
	'catalog_number' => 'C01070012-200',
	'old_catalog_number' => '',
	'sf_code' => 'C01070012-93190',
	'type' => 'FRE',
	'search_order' => '',
	'price_EUR' => '2090',
	'price_USD' => '2090',
	'price_GBP' => '1800',
	'price_JPY' => '327400',
	'price_CNY' => '0',
	'price_AUD' => '5225',
	'country' => 'ALL',
	'except_countries' => 'None',
	'quote' => true,
	'in_stock' => false,
	'featured' => false,
	'no_promo' => false,
	'online' => true,
	'master' => false,
	'last_datasheet_update' => '',
	'slug' => 'tagmentase-loaded-200',
	'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Diagenode',
	'meta_keywords' => '',
	'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
	'modified' => '2024-09-13 15:37:53',
	'created' => '2021-10-21 11:35:59',
	'ProductsGroup' => array(
		'id' => '400',
		'product_id' => '3205',
		'group_id' => '331'
	)
)
$edit = ''
$testimonials = ''
$featured_testimonials = '<blockquote><span class="label-green" style="margin-bottom:16px;margin-left:-22px">TESTIMONIAL</span><p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p><cite>Julia Liz Touza, AstraZeneca Gothenburg, Sweden</cite></blockquote>
'
$testimonial = array(
	'id' => '82',
	'name' => 'Tagmentase',
	'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
	'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
	'featured' => true,
	'slug' => 'testimonial-tagmentase',
	'meta_keywords' => '',
	'meta_description' => '',
	'modified' => '2023-02-08 09:40:13',
	'created' => '2023-02-08 09:37:00',
	'ProductsTestimonial' => array(
		'id' => '200',
		'product_id' => '3165',
		'testimonial_id' => '82'
	)
)
$related_products = '<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/tagmentation-buffer-2x"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01019043</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3162" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3162" id="CartAdd/3162Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3162" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> Tagmentation Buffer (2x)</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
                    'C01019043',
                     '100',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
                    'C01019043',
                    '100',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="tagmentation-buffer-2x" data-reveal-id="cartModal-3162" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">Tagmentation Buffer (2x)</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/24-unique-dual-indexes-for-tagmented-libraries-set1"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01011034</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3158" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3158" id="CartAdd/3158Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3158" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for Tagmented libraries - Set I</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
                    'C01011034',
                     '185',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
                    'C01011034',
                    '185',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set1" data-reveal-id="cartModal-3158" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">24 UDI for Tagmented libraries - Set I</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/atac-seq-kit-24rxns"><img src="/img/product/kits/atacseq-kit-picture.jpg" alt="ATAC-seq kit" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01080002</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3194" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3194" id="CartAdd/3194Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3194" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ATAC-seq kit</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq kit',
                    'C01080002',
                     '1745',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq kit',
                    'C01080002',
                    '1745',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="atac-seq-kit-24rxns" data-reveal-id="cartModal-3194" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">ATAC-seq kit</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/ATAC-seq-package-tissue-C01080006"><img src="/img/grey-logo.jpg" alt="default alt" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01080006</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3215" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3215" id="CartAdd/3215Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3215" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ATAC-seq package for tissue</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
                    'C01080006',
                     '2050',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
                    'C01080006',
                    '2050',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="ATAC-seq-package-tissue-C01080006" data-reveal-id="cartModal-3215" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">ATAC-seq package for tissue</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/tagmentase"><img src="https://www.diagenode.com/img/product/kits/tag-unloaded.png" alt="Tubes" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01070010-10</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3057" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3057" id="CartAdd/3057Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3057" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> Tagmentase (Tn5 transposase) - unloaded</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentase (Tn5 transposase) - unloaded',
                    'C01070010-10',
                     '355',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentase (Tn5 transposase) - unloaded',
                    'C01070010-10',
                    '355',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="tagmentase" data-reveal-id="cartModal-3057" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">Tagmentase</h6>
        </div>

    </div>
</li>
'
$related = array(
	'id' => '3057',
	'antibody_id' => null,
	'name' => 'Tagmentase (Tn5 transposase) - unloaded',
	'description' => '<div class="extra-spaced"><center><img alt="Tagmentase (Tn5 transposase)" src="https://www.diagenode.com/img/banners/banner-tagmentase.jpg" caption="false" width="787" height="236" /></center></div>
<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode Tagmentase is a hyperactive Tn5 transposase with the potential to enhance epigenetic studies. Its ability to cut DNA and insert sequences of interest in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq, ChIPmentation, CHANGE-seq and other. The enzyme is not loaded with DNA oligos, providing flexibility of application. To ensure optimal results the concentration may be adjusted with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> (Cat. No. C01070011), available separately.</p>
<p><a href="https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf" target="_blank">Protocol for transposome assembly</a></p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) you may also need:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for loaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) - loaded</a>.</p>',
	'label1' => 'Quality control',
	'info1' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><img alt="Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1a.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="653" height="282" /></p>
<p><img alt="Tagmentase Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1b.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="645" height="278" /></p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 1: Efficient fragmentation of the lambda DNA after incubation with the Tagmentase</strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with diluted Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). Profiles show the size of lambda DNA before (A) and after treatment with Tagmentase (B).</p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns"><center><img alt="Tn5 transposase perfect for NGS" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure2.jpg" width="754" height="492" /></center></div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 2: Fragmentation efficiency depending on the amount of Tagmentase </strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The Tagmentase was previously diluted with the Tagmentase Dilution Buffer (Cat. No.) at &frac14; and 1/16 dilutions. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). The migration of the samples shows variations of the size distribution according to the amount of Tagmentase used for the reaction.</p>
</div>
</div>',
	'label2' => 'Product information',
	'info2' => '<p><strong>Tagmentase (Tn5 transposase) - unloaded</strong></p>
<div><span style="font-family: inherit;">Protein Molecular weight: 53.3 kDa</span></div>
<p>Expressed: in Escherichia coli</p>
<p><strong>Product description:</strong> Diagenode Tagmentase &ndash; unloaded is a hyperactive Tn5 transposase. The enzyme catalyzes &ldquo;cut and paste&rdquo; tagmentation reaction and can be used to insert any target DNA in vitro.</p>
<p><strong>Storage conditions:</strong> Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer: </strong>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>The enzyme should be loaded with appropriate oligonucleotides prior to use. An efficient transposition require that insert DNA have a specific 19-bp transposase recognition sequence (Mosaic End or ME sequence) at each of its ends. The transposome assembly protocol can be found at https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications: </strong>Tagmentase (Tn5 transposase) &ndash; unloaded can be used in a variety of applications including transgenic experiments, barcoding and library construction for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label3' => '',
	'info3' => '<p></p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'format' => '10 µl',
	'catalog_number' => 'C01070010-10',
	'old_catalog_number' => '',
	'sf_code' => 'C01070010-19650',
	'type' => 'FRE',
	'search_order' => '',
	'price_EUR' => '355',
	'price_USD' => '355',
	'price_GBP' => '320',
	'price_JPY' => '55610',
	'price_CNY' => '0',
	'price_AUD' => '888',
	'country' => 'ALL',
	'except_countries' => 'None',
	'quote' => false,
	'in_stock' => false,
	'featured' => false,
	'no_promo' => false,
	'online' => true,
	'master' => true,
	'last_datasheet_update' => '',
	'slug' => 'tagmentase',
	'meta_title' => 'Tagmentase (Tn5 transposase) -unloaded | Diagenode',
	'meta_keywords' => '',
	'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. The enzyme is not loaded with DNA oligos, providing flexibility of application.',
	'modified' => '2024-09-13 15:48:15',
	'created' => '2020-03-24 17:33:04',
	'ProductsRelated' => array(
		'id' => '4923',
		'product_id' => '3165',
		'related_id' => '3057'
	),
	'Image' => array(
		(int) 0 => array(
			'id' => '1828',
			'name' => 'https://www.diagenode.com/img/product/kits/tag-unloaded.png',
			'alt' => 'Tubes',
			'modified' => '2024-03-28 17:29:30',
			'created' => '2024-03-28 17:29:30',
			'ProductsImage' => array(
				[maximum depth reached]
			)
		)
	)
)
$rrbs_service = array(
	(int) 0 => (int) 1894,
	(int) 1 => (int) 1895
)
$chipseq_service = array(
	(int) 0 => (int) 2683,
	(int) 1 => (int) 1835,
	(int) 2 => (int) 1836,
	(int) 3 => (int) 2684,
	(int) 4 => (int) 1838,
	(int) 5 => (int) 1839,
	(int) 6 => (int) 1856
)
$labelize = object(Closure) {
	
}
$old_catalog_number = ''
$country_code = 'US'
$other_format = array(
	'id' => '3205',
	'antibody_id' => null,
	'name' => 'Tagmentase (Tn5 transposase) - loaded',
	'description' => '<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
	'label1' => 'Examples of results',
	'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label2' => 'Product information',
	'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span><span>&nbsp;</span>3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span><span>&nbsp;</span>correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions:</strong><span>&nbsp;</span>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong><span>&nbsp;</span>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage:&nbsp;</strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong><span>&nbsp;</span>Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div><span>ATAC-seq package for tissue, Cat. No.&nbsp;</span><span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label3' => '',
	'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'format' => '200 μl',
	'catalog_number' => 'C01070012-200',
	'old_catalog_number' => '',
	'sf_code' => 'C01070012-93190',
	'type' => 'FRE',
	'search_order' => '',
	'price_EUR' => '2090',
	'price_USD' => '2090',
	'price_GBP' => '1800',
	'price_JPY' => '327400',
	'price_CNY' => '0',
	'price_AUD' => '5225',
	'country' => 'ALL',
	'except_countries' => 'None',
	'quote' => true,
	'in_stock' => false,
	'featured' => false,
	'no_promo' => false,
	'online' => true,
	'master' => false,
	'last_datasheet_update' => '',
	'slug' => 'tagmentase-loaded-200',
	'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Diagenode',
	'meta_keywords' => '',
	'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
	'modified' => '2024-09-13 15:37:53',
	'created' => '2021-10-21 11:35:59',
	'ProductsGroup' => array(
		'id' => '400',
		'product_id' => '3205',
		'group_id' => '331'
	)
)
$label = '<img src="/img/banners/banner-customizer-back.png" alt=""/>'
$document = array(
	'id' => '1116',
	'name' => 'Datasheet Tagmentase loaded C01070012',
	'description' => '',
	'image_id' => null,
	'type' => 'Datasheet',
	'url' => 'files/products/kits/Datasheet_Tagmentase_loaded_C01070012.pdf',
	'slug' => 'tagmentase-loaded-30-datasheet',
	'meta_keywords' => '',
	'meta_description' => '',
	'modified' => '2020-12-10 17:04:06',
	'created' => '2020-12-10 17:04:06',
	'ProductsDocument' => array(
		'id' => '3059',
		'product_id' => '3165',
		'document_id' => '1116'
	)
)
$sds = array(
	'id' => '2122',
	'name' => 'Tagmentase (Tn5 transposase) - loaded SDS BE nl',
	'language' => 'nl',
	'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-BE-nl-GHS_1_0.pdf',
	'countries' => 'BE',
	'modified' => '2021-10-12 14:34:34',
	'created' => '2021-10-12 14:34:34',
	'ProductsSafetySheet' => array(
		'id' => '3675',
		'product_id' => '3165',
		'safety_sheet_id' => '2122'
	)
)
$publication = array(
	'id' => '4660',
	'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
	'authors' => 'Zolotarev  Nikolay et al.',
	'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to na&iuml;ve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
	'date' => '2022-11-01',
	'pmid' => 'https://doi.org/10.1073%2Fpnas',
	'doi' => '10.1073/pnas.2210595119',
	'modified' => '2023-03-07 09:07:41',
	'created' => '2023-02-21 09:59:46',
	'ProductsPublication' => array(
		'id' => '6552',
		'product_id' => '3165',
		'publication_id' => '4660'
	)
)
$externalLink = ' <a href="https://doi.org/10.1073%2Fpnas" target="_blank"><i class="fa fa-external-link"></i></a>'
include - APP/View/Products/view.ctp, line 755
View::_evaluate() - CORE/Cake/View/View.php, line 971
View::_render() - CORE/Cake/View/View.php, line 933
View::render() - CORE/Cake/View/View.php, line 473
Controller::render() - CORE/Cake/Controller/Controller.php, line 963
ProductsController::slug() - APP/Controller/ProductsController.php, line 1052
ReflectionMethod::invokeArgs() - [internal], line ??
Controller::invokeAction() - CORE/Cake/Controller/Controller.php, line 491
Dispatcher::_invoke() - CORE/Cake/Routing/Dispatcher.php, line 193
Dispatcher::dispatch() - CORE/Cake/Routing/Dispatcher.php, line 167
[main] - APP/webroot/index.php, line 118

Notice (8): Undefined variable: message [APP/View/Products/view.ctp, line 755]Code Context<!-- BEGIN: REQUEST_FORM MODAL -->
<div id="request_formModal" class="reveal-modal medium" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
    <?= $this->element('Forms/simple_form', array('solution_of_interest' => $solution_of_interest, 'header' => $header, 'message' => $message, 'campaign_id' => $campaign_id)) ?>
$viewFile = '/home/website-server/www/app/View/Products/view.ctp'
$dataForView = array(
	'language' => 'cn',
	'meta_keywords' => '',
	'meta_description' => '',
	'meta_title' => 'Tagmentase - loaded - 10',
	'product' => array(
		'Product' => array(
			'id' => '3165',
			'antibody_id' => null,
			'name' => 'Tagmentase (Tn5 transposase) – loaded EARLY ACCESS',
			'description' => '',
			'label1' => '',
			'info1' => '',
			'label2' => '',
			'info2' => '',
			'label3' => '',
			'info3' => '',
			'format' => '10 µl',
			'catalog_number' => 'C01070012-10',
			'old_catalog_number' => '',
			'sf_code' => 'C01070012-19650',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '120',
			'price_USD' => '120',
			'price_GBP' => '115',
			'price_JPY' => '18800',
			'price_CNY' => '',
			'price_AUD' => '300',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => false,
			'last_datasheet_update' => '',
			'slug' => 'tagmentase-loaded-10',
			'meta_title' => 'Tagmentase - loaded - 10',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2024-09-13 14:26:44',
			'created' => '2020-12-08 16:17:54',
			'locale' => 'zho'
		),
		'Antibody' => array(
			'host' => '*****',
			'id' => null,
			'name' => null,
			'description' => null,
			'clonality' => null,
			'isotype' => null,
			'lot' => null,
			'concentration' => null,
			'reactivity' => null,
			'type' => null,
			'purity' => null,
			'classification' => null,
			'application_table' => null,
			'storage_conditions' => null,
			'storage_buffer' => null,
			'precautions' => null,
			'uniprot_acc' => null,
			'slug' => null,
			'meta_keywords' => null,
			'meta_description' => null,
			'modified' => null,
			'created' => null,
			'select_label' => null
		),
		'Slave' => array(),
		'Group' => array(
			'Group' => array(
				[maximum depth reached]
			),
			'Master' => array(
				[maximum depth reached]
			),
			'Product' => array(
				[maximum depth reached]
			)
		),
		'Related' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			),
			(int) 2 => array(
				[maximum depth reached]
			),
			(int) 3 => array(
				[maximum depth reached]
			),
			(int) 4 => array(
				[maximum depth reached]
			)
		),
		'Application' => array(),
		'Category' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Document' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Feature' => array(),
		'Image' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Promotion' => array(),
		'Protocol' => array(),
		'Publication' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			),
			(int) 2 => array(
				[maximum depth reached]
			),
			(int) 3 => array(
				[maximum depth reached]
			),
			(int) 4 => array(
				[maximum depth reached]
			),
			(int) 5 => array(
				[maximum depth reached]
			),
			(int) 6 => array(
				[maximum depth reached]
			),
			(int) 7 => array(
				[maximum depth reached]
			),
			(int) 8 => array(
				[maximum depth reached]
			),
			(int) 9 => array(
				[maximum depth reached]
			),
			(int) 10 => array(
				[maximum depth reached]
			),
			(int) 11 => array(
				[maximum depth reached]
			),
			(int) 12 => array(
				[maximum depth reached]
			),
			(int) 13 => array(
				[maximum depth reached]
			),
			(int) 14 => array(
				[maximum depth reached]
			),
			(int) 15 => array(
				[maximum depth reached]
			)
		),
		'Testimonial' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Area' => array(),
		'SafetySheet' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			),
			(int) 2 => array(
				[maximum depth reached]
			),
			(int) 3 => array(
				[maximum depth reached]
			),
			(int) 4 => array(
				[maximum depth reached]
			),
			(int) 5 => array(
				[maximum depth reached]
			),
			(int) 6 => array(
				[maximum depth reached]
			),
			(int) 7 => array(
				[maximum depth reached]
			)
		)
	),
	'meta_canonical' => 'https://www.diagenode.com/cn/p/tagmentase-loaded-30'
)
$language = 'cn'
$meta_keywords = ''
$meta_description = ''
$meta_title = 'Tagmentase - loaded - 10'
$product = array(
	'Product' => array(
		'id' => '3165',
		'antibody_id' => null,
		'name' => 'Tagmentase (Tn5 transposase) – loaded EARLY ACCESS',
		'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns">
<p>&nbsp;</p>
<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
		'label1' => 'Examples of results',
		'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label2' => 'Product information',
		'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span> 3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span> correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions: </strong>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong> Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong> Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div>ATAC-seq package for tissue, Cat. No.&nbsp;<span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label3' => '',
		'info3' => '',
		'format' => '10 µl',
		'catalog_number' => 'C01070012-10',
		'old_catalog_number' => '',
		'sf_code' => 'C01070012-19650',
		'type' => 'FRE',
		'search_order' => '',
		'price_EUR' => '120',
		'price_USD' => '120',
		'price_GBP' => '115',
		'price_JPY' => '18800',
		'price_CNY' => '',
		'price_AUD' => '300',
		'country' => 'ALL',
		'except_countries' => 'None',
		'quote' => false,
		'in_stock' => false,
		'featured' => false,
		'no_promo' => false,
		'online' => true,
		'master' => false,
		'last_datasheet_update' => '',
		'slug' => 'tagmentase-loaded-10',
		'meta_title' => 'Tagmentase - loaded - 10',
		'meta_keywords' => '',
		'meta_description' => '',
		'modified' => '2024-09-13 14:26:44',
		'created' => '2020-12-08 16:17:54',
		'locale' => 'zho'
	),
	'Antibody' => array(
		'host' => '*****',
		'id' => null,
		'name' => null,
		'description' => null,
		'clonality' => null,
		'isotype' => null,
		'lot' => null,
		'concentration' => null,
		'reactivity' => null,
		'type' => null,
		'purity' => null,
		'classification' => null,
		'application_table' => null,
		'storage_conditions' => null,
		'storage_buffer' => null,
		'precautions' => null,
		'uniprot_acc' => null,
		'slug' => null,
		'meta_keywords' => null,
		'meta_description' => null,
		'modified' => null,
		'created' => null,
		'select_label' => null
	),
	'Slave' => array(),
	'Group' => array(
		'Group' => array(
			'id' => '331',
			'name' => 'C01070012',
			'product_id' => '3164',
			'modified' => '2020-12-08 16:19:24',
			'created' => '2020-12-08 16:19:24'
		),
		'Master' => array(
			'id' => '3164',
			'antibody_id' => null,
			'name' => 'Tagmentase (Tn5 transposase) - loaded',
			'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns">
<p>&nbsp;</p>
<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
			'label1' => 'Examples of results',
			'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => 'Product information',
			'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span> 3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span> correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions: </strong>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong> Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong> Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div>ATAC-seq package for tissue, Cat. No.&nbsp;<span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '30 μl',
			'catalog_number' => 'C01070012-30',
			'old_catalog_number' => '',
			'sf_code' => 'C01070012-143301',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '330',
			'price_USD' => '330',
			'price_GBP' => '300',
			'price_JPY' => '51695',
			'price_CNY' => '',
			'price_AUD' => '825',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => true,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'tagmentase-loaded-30',
			'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 30 | Diagenode',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
			'modified' => '2024-09-13 15:36:59',
			'created' => '2020-12-08 16:15:40'
		),
		'Product' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			)
		)
	),
	'Related' => array(
		(int) 0 => array(
			'id' => '3162',
			'antibody_id' => null,
			'name' => 'Tagmentation Buffer (2x)',
			'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode <strong>Tagmentation Buffer (2x)</strong> is the recommended reagent to perform any tagmentation reactions. It can be used in combination with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase)</a> on DNA or chromatin samples, as half of the total volume reaction like in ATAC-seq protocol.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
 var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); } 
// ]]></script>
</center></div>
</div>
<p></p>',
			'label1' => 'Examples of use',
			'info1' => '<p><span style="text-decoration: underline;">ATAC-seq experiments: </span></p>
<ul style="list-style-type: circle;">
<li>After cell lysis and nuclei isolation, the nuclei pellets can be incubated with the following mix for 1 reaction:</li>
</ul>
<table style="width: 447px;">
<tbody>
<tr>
<td style="width: 326px;">Tagmentation Buffer (2x)</td>
<td style="width: 114px; padding-left: 30px;">25 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Tagmentase loaded</td>
<td style="width: 114px; padding-left: 30px;">2.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;"><span>Digitonin 1%</span></td>
<td style="width: 114px; padding-left: 30px;">0.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Tween20 10%</td>
<td style="width: 114px; padding-left: 30px;">0.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">PBS</td>
<td style="width: 114px; padding-left: 30px;">16.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Nuclease-free water</td>
<td style="width: 114px; padding-left: 30px;">&nbsp;5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Nuclei pellet*</td>
<td style="width: 114px;"></td>
</tr>
</tbody>
</table>
<p><em>*&nbsp; The number of nuclei per reaction will depend on the ATAC-seq experimental design. Successful tagmentation with the proposed protocol has been performed on 50,000 nuclei per reaction.&nbsp;</em></p>
<ul style="list-style-type: circle;">
<li>The reaction is then incubated 30 minutes at 37&deg;C.</li>
<li>The tagmentation reaction can then be stopped by addition of 250 &micro;l of DNA Binding buffer from Diagenode MicroChIP DiaPure Columns (Cat. No. C03040001).</li>
<li>The tagmented libraries can then be purified using the MicroChIP DiaPure Columns (Cat. No. C03040001), and amplified.</li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => '',
			'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '300 µl ',
			'catalog_number' => 'C01019043',
			'old_catalog_number' => '',
			'sf_code' => 'C01019043-29421',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '90',
			'price_USD' => '100',
			'price_GBP' => '105',
			'price_JPY' => '14100',
			'price_CNY' => '',
			'price_AUD' => '250',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'tagmentation-buffer-2x',
			'meta_title' => 'Tagmentation Buffer 2x',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2023-06-20 18:19:03',
			'created' => '2020-12-08 16:00:14',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		),
		(int) 1 => array(
			'id' => '3158',
			'antibody_id' => null,
			'name' => '24 UDI for Tagmented libraries - Set I',
			'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries</strong> includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">&mu;ChIPmentation for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&amp;Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><strong>24 UDI for tagmented libraries - Set I</strong><br /> <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries -&nbsp; Set III</a><br /><br /></p>
<p><span>Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</span></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples&nbsp;</b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label1' => 'Characteristics',
			'info1' => '<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries &ndash; Set I </b>is compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&amp;Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of &micro;ChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the &micro;ChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries &ndash; Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => '',
			'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '24 UDI',
			'catalog_number' => 'C01011034',
			'old_catalog_number' => '',
			'sf_code' => 'C01011034-',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '165',
			'price_USD' => '185',
			'price_GBP' => '155',
			'price_JPY' => '25845',
			'price_CNY' => '',
			'price_AUD' => '462',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set1',
			'meta_title' => '24 unique dual indexes for tagmented libraries set 1',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2024-05-15 10:25:12',
			'created' => '2020-12-08 15:26:23',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		),
		(int) 2 => array(
			'id' => '3194',
			'antibody_id' => null,
			'name' => 'ATAC-seq kit',
			'description' => '<p><a href="https://www.diagenode.com/files/products/kits/atacseq-kit-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p><strong>ATAC-seq</strong>, Assay for<span>&nbsp;</span><strong>T</strong>ransposase-<strong>A</strong>ccessible<span>&nbsp;</span><strong>C</strong>hromatin, followed by next generation sequencing, is a key technology for genome-wide mapping of accessible chromatin. The technology is based on the use of the<span>&nbsp;</span><strong>transposase Tn5</strong><span>&nbsp;</span>which cuts exposed open chromatin and simultaneously ligates adapters for subsequent amplification and sequencing. ATAC-seq methods allow you to:</p>
<ul>
<li>&nbsp;Gain insight into gene regulation and understand open chromatin signatures</li>
<li>&nbsp;Determine nucleosome positions at single nucleotide resolution</li>
<li>&nbsp;Uncover transcription factor (TF) occupancy</li>
</ul>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Diagenode&rsquo;s<span>&nbsp;</span><b>ATAC-</b><b>seq</b><b><span>&nbsp;</span>kit<span>&nbsp;</span></b>is based on a highly validated protocol optimized for<span>&nbsp;</span><b>50,000<span>&nbsp;</span></b><b>cells</b><b><span>&nbsp;</span>per<span>&nbsp;</span></b><b>reaction</b>. The kit includes the reagents for cell lysis and nuclei extraction, tagmentation and DNA purification as well as for library amplification. The <a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">primer indexes for multiplexing</a> are not included in the kit and must be purchased separately.</p>
<h4><span style="font-weight: 400;">ATAC-seq kit features:</span></h4>
<ul>
<li><b>Cell<span>&nbsp;</span></b><b>requirement</b><b>:<span>&nbsp;</span></b><b>50,000<span>&nbsp;</span></b><b>cells /<span>&nbsp;</span></b><b>rxn</b></li>
<li><b>Robust protocol<span>&nbsp;</span></b>with<span>&nbsp;</span><b>high reproducibility<span>&nbsp;</span></b>between replicates and repetitive experiments</li>
<li><strong>Easy</strong><span>&nbsp;</span>and<span>&nbsp;</span><b>efficient DNA capture<span>&nbsp;</span></b>after the tagmentation reaction using Diagenode`s MicroChIP DiaPure columns (included)</li>
<li>Additional qPCR step to determine the number of cycles needed for library amplification: &nbsp;</li>
<ul type="&rdquo;square&rdquo;">
<li><b>Avoids<span>&nbsp;</span></b><b>over-amplification</b></li>
<li>Allows adaptation/flexibility for<span>&nbsp;</span><b>more challenging samples<span>&nbsp;</span></b>to succeed with library prep.</li>
<li>Gives<span>&nbsp;</span><strong>early indication</strong><span>&nbsp;</span>if the experiment does not work (no qPCR amplification)</li>
</ul>
</ul>
<p>Looking for ATAC-seq on tissue? Please, go to: <a href="https://www.diagenode.com/en/p/ATAC-seq-package-tissue-C01080006">ATAC-seq package for tissue</a></p>',
			'label1' => 'Method overview',
			'info1' => '<p><strong>ATAC-seq</strong>, <strong>A</strong>ssay for <strong>T</strong>ransposase-<strong>A</strong>ccessible <strong>C</strong>hromatin, followed by next generation sequencing, is a key technology to easily identify the <strong>open regions of the chromatin.</strong> The protocol consists of <strong>3 steps</strong>: <strong>nuclei preparation</strong>, <strong>tagmentation</strong> and <strong>library amplification</strong>. First, the cells undergo the lysis, ending with the crude nuclei. Then, the nuclei are incubated with a tagmentase (Tn5 transposase), which &nbsp;cuts the genomic regions associated with open chromatin and inserts the sequencing adaptors. Finally, the generated libraries are amplified and can be used for sequencing. High-throughput sequencing will then detect peaks, in open regions of the chromatin only, giving a map of the chromatin status in the whole genome of the sample.</p>
<p><img src="https://www.diagenode.com/img/product/kits/workflow-atac-seq.png" alt="ATAC-seq kit workflow" width="600px" caption="false" /></p>',
			'label2' => 'Example of results',
			'info2' => '<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig1.png" alt="library prepared with the Diagenode ATAC-seq kit " width="500px" caption="false" /></p>
<p><strong>Figure 1.</strong>Representative Bioanalyzer profile of an ATAC-seq library prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells.</p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig2.png" alt="Diagenode ATAC-seq kit " caption="false" width="951" height="148" /></p>
<p><strong>Figure 2.</strong> Main ATAC-seq alignment and peak calling statistics of 3 replicates prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells. (Mapping efficiency: Percentage of non-mitochondrial reads that mapped to the reference genome. Uniquely mapped ratio: Proportion of mapped reads that map to only one location on the reference genome (hg19). Peaks: Number of peaks (open chromatin regions) identified by MACS2 for each sample. FRiP - Fraction of reads in peaks: Percentage of reads in peaks, with respect to the number of uniquely mapped reads. Sequencing was realized in paired-end mode 50 base pairs (PE50) on an Illumina NovaSeq6000.)</p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig3a.png" alt="Assay for Transposase-Accessible Chromatin" width="500px" caption="false" /></p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig3b.png" alt="Assay for Transposase-Accessible Chromatin" width="500px" caption="false" /></p>
<p><strong>Figure 3</strong> Sequencing profiles of ATAC-seq library (3 replicates) prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells.</p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig4.png" alt=" open chromatin regions" caption="false" width="383" height="739" /></p>
<p><strong>Figure 4. </strong><br /> Heatmap around TSS of three ATAC-seq replicates prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells.</p>',
			'label3' => 'Additional solutions for ATAC-seq kit',
			'info3' => '<p><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes for tagmented libraries</a></p>
<p>Magnetic rack:<span>&nbsp;</span><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag</a><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit"><span>&nbsp;</span>0.2 ml &ndash; Cat. No. B04000001</a></p>
<p>Additional supplies (included in the kit and available separately):</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30"><span>&nbsp;</span>(Tn5 transposase)<span>&nbsp;</span></a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">loaded</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">, Cat. No. C01070012</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation</a><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x"><span>&nbsp;</span>Buffer (2x), Cat. No. C01019043</a></li>
<li><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">MicroChIP</a><span>&nbsp;</span><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">DiaPure</a><span>&nbsp;</span><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">columns</a><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">, Cat. No. C03040001</a></li>
</ul>',
			'format' => '24 rxns',
			'catalog_number' => 'C01080002',
			'old_catalog_number' => '',
			'sf_code' => 'C01080002-',
			'type' => 'RFR',
			'search_order' => '',
			'price_EUR' => '1740',
			'price_USD' => '1745',
			'price_GBP' => '1485',
			'price_JPY' => '272570',
			'price_CNY' => '',
			'price_AUD' => '4362',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'atac-seq-kit-24rxns',
			'meta_title' => 'ATAC-seq kit for open chromatin assessment C01080001 | Diagenode ',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode’s ATAC-seq kit provides a robust protocol for assessing genome-wide chromatin accessibility',
			'modified' => '2024-10-21 10:11:12',
			'created' => '2021-07-01 15:46:58',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		),
		(int) 3 => array(
			'id' => '3215',
			'antibody_id' => null,
			'name' => 'ATAC-seq package for tissue',
			'description' => '<p><a href="https://www.diagenode.com/files/products/kits/atacseq-kit-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p><b>ATAC-seq</b>, Assay for&nbsp;<b>T</b>ransposase-<b>A</b>ccessible&nbsp;<b>C</b>hromatin, followed by next generation sequencing, is a key technology for genome-wide mapping of accessible chromatin. The technology is based on the use of the&nbsp;<b>transposase Tn5</b>&nbsp;which cuts exposed open chromatin and simultaneously ligates adapters for subsequent amplification and sequencing.</p>
<p>The Diagenode&rsquo;s <b>ATAC-</b><b>seq</b><b> package for tissue </b>has been specifically developted and optimized to generate the ATAC-seq libraries from tissue samples on <b>25 to 100 mg of tissue per </b><b>reaction</b>. The protocol has been validated on many different mammalian tissues (lung, liver, brain, kidney, muscles) and different species (pork, chicken, rat, mice, horse). The package includes the reagents for complete ATAC-seq workflow, including nuclei extraction, library preparation and multiplexing.</p>
<p><strong>Content of the ATAC-seq package for tissues:</strong></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004" target="_blank" title="Tissue Nuclei Extraction for ATAC-seq">Tissue<span>&nbsp;</span>Nuclei<span>&nbsp;</span>Extraction for ATAC-seq</a><span>&nbsp;</span>&ndash; optimized protocol and reagents for highly efficient nuclei isolation from tissue, preserving the nuclei</li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq<span>&nbsp;</span>kit</a><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns"><span>&nbsp;</span></a>&ndash; generation of high quality libraries</li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24&nbsp;UDI for<span>&nbsp;</span>tagmented<span>&nbsp;</span>libraries*</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries"><span>&nbsp;</span></a>&ndash; efficient multiplexing allowing for index hopping identification and filtering.&nbsp;</li>
</ul>
<p><strong>Features:</strong></p>
<ul>
<li>Complete solution for the ATAC-seq workflow</li>
<li>Highly efficient nuclei extraction from tissue</li>
<li>Validated on many mammalian tissues</li>
<li>Compatible with Illumina sequencing platforms</li>
</ul>
<p>Looking for ATAC-seq for cells? Please go to<span>&nbsp;</span><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns">ATAC-seq kit</a>.</p>
<p><em>* For libraries multiplexing, the ATAC-seq package 24 rxns includes&nbsp; the 24 UDI for tagmented libraries kit - set I, Cat. No. C01011034. If needed, higher multiplexing is possible using other sets of <a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries" target="_blank" title="Primer indexes for tagmented libraries">Primer indexes for tagmented libraries</a>, available separately.</em></p>
<p></p>
<p><small><img src="https://icons.iconarchive.com/icons/wikipedia/flags/256/EU-European-Union-Flag-icon.png" alt="" width="45" />&nbsp; The project GENE-SWitCH leading to this application has received funding from the European Union&rsquo;s Horizon 2020 research and innovation programme under the grant agreement No 817998.<small></small></small></p>',
			'label1' => 'Method overview',
			'info1' => '<p><b>ATAC-seq</b>, <b>A</b>ssay for <b>T</b>ransposase-<b>A</b>ccessible <b>C</b>hromatin, followed by next generation sequencing, is a key technology to easily identify the <b>open regions of the chromatin.</b> The protocol consists of <b>3 steps</b>: <b>nuclei preparation</b>, <b>tagmentation</b> and <b>library amplification</b>. First, the tissue undergoes lysis, ending with the crude nuclei. Then, the nuclei are incubated with a tagmentase (Tn5 transposase), which cuts the genomic regions associated with open chromatin and inserts the sequencing adaptors. Finally, the generated libraries are amplified and can be used for sequencing. High-throughput sequencing will then detect peaks, in open regions of the chromatin only, giving a map of the chromatin status in the whole genome of the sample.</p>
<p><br /> <img src="https://www.diagenode.com/img/product/kits/workflow-atac-seq-tissue.png" alt="workflow" style="display: block; margin-left: auto; margin-right: auto;" width="600px" /></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => 'Example of results',
			'info2' => '<p>GENE-SWitCH aims to deliver new underpinning knowledge on the functional genomes of two main monogastric farm species (pig and chicken) and to enable immediate translation to the pig and poultry sectors. It is a multi-actor project that will produce new genome information to enable the characterization of genetic and epigenetic determinants of complex traits in these two species. Diagenode, as a principal participant to the project and leading the WP1, developed a new protocol to improve the preparation of ATAC-seq libraries from a variety of snap-frozen tissues. The ATAC-seq protocol combines efficient nuclei extraction procedure validated on 7 different kinds of tissues from 3 developmental stages of the two species and a robust Tagmentation protocol based on Diagenode Tn5 enzyme. The developed ATAC-seq protocol was successfully used to produce 168 ATAC-seq libraries for WP1 and 320 for WP5.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/table1-atacseq-results.png" width="400" /></center>
<p><small><strong>Table 1.</strong> List of validated tissues with Diagenode&rsquo;s ATAC-seq package for tissue (Cat. No. C01080005/6). The samples were used as part of GENE-SWitCH consortium.</small></p>
<p>A.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2a-atacseq-results.png" width="700" /></center>
<p>B.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2b-atacseq-results.png" width="700" /></center>
<p><small><strong>Figure 2.</strong> ATAC-seq library profiles generated using the ATAC-seq package for tissue (Cat. No. C01080005/6) from pork&rsquo;s liver (A) and brain (B). The samples were used as part of GENE-SWitCH consortium.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => 'Additional solutions for ATAC-seq for tissue',
			'info3' => '<p>Additional supplies (included in the kit and available separately):</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">&nbsp;(Tn5 transposase)&nbsp;loaded, Cat. No. C01070012</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation</a><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">&nbsp;Buffer (2x), Cat. No. C01019043</a></li>
<li><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">MicroChIP</a>&nbsp;<a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">DiaPure</a>&nbsp;<a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">columns, Cat. No. C03040001</a></li>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004">Tissue Nuclei Extraction for ATAC-seq, Cat. No. C0108004</a></li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq kit, Cat. No. C01080002</a></li>
</ul>
<p>Other supplies:</p>
<ul>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes for tagmented libraries</a></li>
<li><a href="https://www.diagenode.com/en/p/protease-inhibitor-mix-100-ul">Protease Inhibitor Mix 200X</a></li>
<li>Magnetic rack:&nbsp;<a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag</a><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">&nbsp;0.2 ml &ndash; Cat. No. B04000001</a></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '24 rxns',
			'catalog_number' => 'C01080006',
			'old_catalog_number' => '',
			'sf_code' => 'C01080006-',
			'type' => 'RFR',
			'search_order' => '',
			'price_EUR' => '2050',
			'price_USD' => '2050',
			'price_GBP' => '1765',
			'price_JPY' => '321130',
			'price_CNY' => '',
			'price_AUD' => '5125',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'ATAC-seq-package-tissue-C01080006',
			'meta_title' => 'ATAC-seq package for tissue|Diagenode C01080006',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode’s ATAC-seq package for tissue provides a robust protocol for assessing genome-wide chromatin accessibility on tissue samples. ',
			'modified' => '2023-04-06 11:06:44',
			'created' => '2022-03-23 16:37:31',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array([maximum depth reached])
		),
		(int) 4 => array(
			'id' => '3057',
			'antibody_id' => null,
			'name' => 'Tagmentase (Tn5 transposase) - unloaded',
			'description' => '<div class="extra-spaced"><center><img alt="Tagmentase (Tn5 transposase)" src="https://www.diagenode.com/img/banners/banner-tagmentase.jpg" caption="false" width="787" height="236" /></center></div>
<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode Tagmentase is a hyperactive Tn5 transposase with the potential to enhance epigenetic studies. Its ability to cut DNA and insert sequences of interest in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq, ChIPmentation, CHANGE-seq and other. The enzyme is not loaded with DNA oligos, providing flexibility of application. To ensure optimal results the concentration may be adjusted with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> (Cat. No. C01070011), available separately.</p>
<p><a href="https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf" target="_blank">Protocol for transposome assembly</a></p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) you may also need:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for loaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) - loaded</a>.</p>',
			'label1' => 'Quality control',
			'info1' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><img alt="Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1a.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="653" height="282" /></p>
<p><img alt="Tagmentase Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1b.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="645" height="278" /></p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 1: Efficient fragmentation of the lambda DNA after incubation with the Tagmentase</strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with diluted Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). Profiles show the size of lambda DNA before (A) and after treatment with Tagmentase (B).</p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns"><center><img alt="Tn5 transposase perfect for NGS" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure2.jpg" width="754" height="492" /></center></div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 2: Fragmentation efficiency depending on the amount of Tagmentase </strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The Tagmentase was previously diluted with the Tagmentase Dilution Buffer (Cat. No.) at &frac14; and 1/16 dilutions. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). The migration of the samples shows variations of the size distribution according to the amount of Tagmentase used for the reaction.</p>
</div>
</div>',
			'label2' => 'Product information',
			'info2' => '<p><strong>Tagmentase (Tn5 transposase) - unloaded</strong></p>
<div><span style="font-family: inherit;">Protein Molecular weight: 53.3 kDa</span></div>
<p>Expressed: in Escherichia coli</p>
<p><strong>Product description:</strong> Diagenode Tagmentase &ndash; unloaded is a hyperactive Tn5 transposase. The enzyme catalyzes &ldquo;cut and paste&rdquo; tagmentation reaction and can be used to insert any target DNA in vitro.</p>
<p><strong>Storage conditions:</strong> Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer: </strong>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>The enzyme should be loaded with appropriate oligonucleotides prior to use. An efficient transposition require that insert DNA have a specific 19-bp transposase recognition sequence (Mosaic End or ME sequence) at each of its ends. The transposome assembly protocol can be found at https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications: </strong>Tagmentase (Tn5 transposase) &ndash; unloaded can be used in a variety of applications including transgenic experiments, barcoding and library construction for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '10 µl',
			'catalog_number' => 'C01070010-10',
			'old_catalog_number' => '',
			'sf_code' => 'C01070010-19650',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '355',
			'price_USD' => '355',
			'price_GBP' => '320',
			'price_JPY' => '55610',
			'price_CNY' => '0',
			'price_AUD' => '888',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'tagmentase',
			'meta_title' => 'Tagmentase (Tn5 transposase) -unloaded | Diagenode',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. The enzyme is not loaded with DNA oligos, providing flexibility of application.',
			'modified' => '2024-09-13 15:48:15',
			'created' => '2020-03-24 17:33:04',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		)
	),
	'Application' => array(),
	'Category' => array(
		(int) 0 => array(
			'id' => '3',
			'position' => '4',
			'parent_id' => null,
			'name' => 'Kits',
			'description' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p style="text-align: justify;">Diagenode&rsquo;s epigenetic reagents include:</p>
<ul>
<li style="text-align: justify;"><strong>DNA methylation kits and antibodies</strong> - Validated&nbsp;NGS-compatible kits for MeDIP, MBD pull-down, whole genome bisulfite sequencing, and reduced representation bisulfite sequencing. Official provider for the original clone for 5-mC 33D3.</li>
<li style="text-align: justify;"><strong>ChIP and ChIP-seq kits for industry-leading specificity and sensitivity</strong> - MicroChIP/MicroPlex Kit for ChIP-seq with only 10,000 cells and the iDeal ChIP-seq Kits optimized for both transcription factors and histones. Our kits feature full reagents for ChIP-seq including control primers, control antibodies, magnetics beads, and purification reagents.</li>
<li style="text-align: justify;"><strong>Library preparation kits</strong> tailored for your specific requirements. The MicroPlex Library Preparation Kit simplifies library preparation requiring only 3 simple steps and allowing inputs of only 50 pg.&nbsp;</li>
</ul>
</div>
</div>',
			'no_promo' => false,
			'in_menu' => false,
			'online' => true,
			'tabular' => false,
			'hide' => false,
			'all_format' => false,
			'is_antibody' => false,
			'slug' => 'kits',
			'cookies_tag_id' => null,
			'meta_keywords' => 'DNA methylation Kits,ChIP and ChIP-seq kits,Library preparation kits,MicroChIP/MicroPlex Kit,iDeal Library Preparation Kit',
			'meta_description' => 'Diagenode provides Isotype controls for Methylated DNA Immunoprecipitation',
			'meta_title' => 'Isotype controls for Methylated DNA Immunoprecipitation | Diagenode',
			'modified' => '2019-07-03 10:48:00',
			'created' => '2014-11-13 22:28:36',
			'ProductsCategory' => array(
				[maximum depth reached]
			),
			'CookiesTag' => array([maximum depth reached])
		)
	),
	'Document' => array(
		(int) 0 => array(
			'id' => '1116',
			'name' => 'Datasheet Tagmentase loaded C01070012',
			'description' => '',
			'image_id' => null,
			'type' => 'Datasheet',
			'url' => 'files/products/kits/Datasheet_Tagmentase_loaded_C01070012.pdf',
			'slug' => 'tagmentase-loaded-30-datasheet',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2020-12-10 17:04:06',
			'created' => '2020-12-10 17:04:06',
			'ProductsDocument' => array(
				[maximum depth reached]
			)
		)
	),
	'Feature' => array(),
	'Image' => array(
		(int) 0 => array(
			'id' => '1829',
			'name' => 'https://www.diagenode.com/img/product/kits/tag-loaded.png',
			'alt' => 'Tubes',
			'modified' => '2024-03-28 17:30:39',
			'created' => '2024-03-28 17:30:39',
			'ProductsImage' => array(
				[maximum depth reached]
			)
		)
	),
	'Promotion' => array(),
	'Protocol' => array(),
	'Publication' => array(
		(int) 0 => array(
			'id' => '5002',
			'name' => 'HIRA protects telomeres against R-loop-induced instability in ALT cancer cells',
			'authors' => 'Michelle Lee Lynskey et al.',
			'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HIRA establishes greater telomeric chromatin accessibility after ATRX-DAXX loss</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">Deposition of new H3.3 by HIRA-UBN restricts telomeric ssDNA and TERRA R-loops</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">Unresolved TERRA R-loops block new H3.3 deposition by HIRA-UBN</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">CHK1 phosphorylation of H3.3 is critical to prevent ssDNA and TERRA R-loop buildup</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">Inactivating mutations in chromatin modifiers, like the &alpha;-thalassemia/mental retardation, X-linked (ATRX)-death domain-associated protein (DAXX) chromatin remodeling/histone H3.3 deposition complex, drive the cancer-specific alternative lengthening of telomeres (ALT) pathway. Prior studies revealed that HIRA, another histone H3.3 chaperone, compensates for ATRX-DAXX loss at telomeres to sustain ALT cancer cell survival. How HIRA rescues telomeres from the consequences of ATRX-DAXX deficiency remains unclear. Here, using an assay for transposase-accessible chromatin using sequencing (ATAC-seq) and cleavage under targets and release using nuclease (CUT&amp;RUN), we establish that HIRA-mediated deposition of new H3.3 maintains telomeric chromatin accessibility to prevent the detrimental accumulation of nucleosome-free single-stranded DNA (ssDNA) in ATRX-DAXX-deficient ALT cells. We show that the HIRA-UBN1/UBN2 complex deposits new H3.3 to prevent TERRA R-loop buildup and transcription-replication conflicts (TRCs) at telomeres. Furthermore, HIRA-mediated H3.3 incorporation into telomeric chromatin links productive ALT to the phosphorylation of serine 31, an H3.3-specific amino acid, by Chk1. Therefore, we identify a critical role for HIRA-mediated H3.3 deposition that ensures the survival of ATRX-DAXX-deficient ALT cancer cells.</div>
</section>
<section id="graphical-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name"></h2>
</section>',
			'date' => '2024-11-26',
			'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01315-9',
			'doi' => '10.1016/j.celrep.2024.114964',
			'modified' => '2024-11-12 09:41:40',
			'created' => '2024-11-12 09:41:40',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 1 => array(
			'id' => '4996',
			'name' => 'ARMC5 selectively degrades SCAP-free SREBF1 and is essential for fatty acid desaturation in adipocytes',
			'authors' => 'Akifumi Uota et al.',
			'description' => '<p><span>SREBF1 plays the central role in lipid metabolism. It has been known that full-length SREBF1 that did not associate with SCAP (SCAP-free SREBF1) is actively degraded, but its molecular mechanism and its biological meaning remain unclear. ARMC5-CUL3 complex was recently identified as E3 ubiquitin ligase of full-length SREBF. Although ARMC5 was involved in SREBF pathway in adrenocortical cells, the role of ARMC5 in adipocytes has not been investigated. In this study, adipocyte-specific&nbsp;</span><em>Armc5</em><span><span>&nbsp;</span>knockout mice were generated. In the white adipose tissue (WAT) of these mice, all the stearoyl-CoA desaturase (</span><em>Scd</em><span>) were drastically downregulated. Consistently, unsaturated fatty acids were decreased and saturated fatty acids were increased. The protein amount of full-length SREBF1 were increased, but ATAC-Seq peaks at the SREBF1-binding sites were markedly diminished around the<span>&nbsp;</span></span><em>Scd1</em><span><span>&nbsp;</span>locus in the WAT of<span>&nbsp;</span></span><em>Armc5</em><span><span>&nbsp;</span>knockout mice. Armc5-deficient 3T3-L1 adipocytes also exhibited downregulation of<span>&nbsp;</span></span><em>Scd</em><span>. Mechanistically, disruption of<span>&nbsp;</span></span><em>Armc5</em><span><span>&nbsp;</span>restored decreased full-length SREBF1 in CHO cells deficient for<span>&nbsp;</span></span><em>Scap</em><span>. Overexpression of<span>&nbsp;</span></span><em>Scap</em><span><span>&nbsp;</span>inhibited ARMC5-mediated degradation of full-length SREBF1, and overexpression of<span>&nbsp;</span></span><em>Armc5</em><span><span>&nbsp;</span>increased nuclear SREBF1/full-length SREBF1 ratio and SREBF1 transcriptional activity in the presence of exogenous SCAP. These results demonstrated that ARMC5 selectively removes SCAP-free SREBF1 and stimulates SCAP-mediated SREBF1 processing, hence is essential for fatty acid desaturation<span>&nbsp;</span></span><em>in vivo</em><span>.</span></p>',
			'date' => '2024-11-02',
			'pmid' => 'https://www.sciencedirect.com/science/article/pii/S0021925824024554',
			'doi' => 'https://doi.org/10.1016/j.jbc.2024.107953',
			'modified' => '2024-11-05 08:33:28',
			'created' => '2024-11-05 08:33:28',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 2 => array(
			'id' => '4985',
			'name' => 'HNF1β bookmarking involves Topoisomerase 1 activation and DNA topology relaxation in mitotic chromatin',
			'authors' => 'Alessia Bagattin et al.',
			'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HNF1&beta; mitotic site binding is preserved with a specific methanol/formaldehyde ChIP</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">BTBD2, an HNF1&beta; partner, mediates mitosis-specific interaction with TOP1</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">HNF1&beta; recruits TOP1 and induces DNA relaxation around bookmarked HNF1&beta; sites</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">An HNF1&beta; mutation, found in MODY patients, disrupts the interaction with TOP1</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">HNF1&beta; (<i>HNF1B</i>) is a transcription factor frequently mutated in patients with developmental renal disease. It binds to mitotic chromatin and reactivates gene expression after mitosis, a phenomenon referred to as bookmarking. Using a crosslinking method that circumvents the artifacts of formaldehyde, we demonstrate that&nbsp;HNF1&beta; remains associated with chromatin in a sequence-specific way in both interphase and mitosis. We identify an HNF1&beta;-interacting protein, BTBD2, that enables the interaction and activation of Topoisomerase 1 (TOP1) exclusively during mitosis. Our study identifies a shared microhomology domain between HNF1&beta; and TOP1, where a mutation, found in &ldquo;maturity onset diabetes of the young&rdquo; patients, disrupts their interaction. Importantly, HNF1&beta; recruits TOP1 and induces DNA relaxation around HNF1&beta; mitotic chromatin sites, elucidating its crucial role in chromatin remodeling and gene reactivation after mitotic exit. These findings shed light on how HNF1&beta; reactivates target gene expression after mitosis, providing insights into its crucial role in maintenance of cellular identity.</div>
</section>',
			'date' => '2024-10-08',
			'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01156-2',
			'doi' => '10.1016/j.celrep.2024.114805',
			'modified' => '2024-10-14 09:04:44',
			'created' => '2024-10-14 09:04:44',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 3 => array(
			'id' => '4969',
			'name' => 'Nuclear lamin A/C phosphorylation by loss of androgen receptor leads to cancer-associated fibroblast activation',
			'authors' => 'Ghosh S. et al.',
			'description' => '<p><span>Alterations in nuclear structure and function are hallmarks of cancer cells. Little is known about these changes in Cancer-Associated Fibroblasts (CAFs), crucial components of the&nbsp;tumor microenvironment. Loss of the androgen receptor (AR) in human dermal fibroblasts (HDFs), which triggers early steps of CAF activation, leads to nuclear membrane changes and micronuclei formation, independent of cellular senescence. Similar changes occur in established CAFs and are reversed by restoring AR activity. AR associates with nuclear lamin A/C, and its loss causes lamin A/C nucleoplasmic redistribution. AR serves as a bridge between lamin A/C and the protein phosphatase PPP1. Loss of AR decreases lamin-PPP1 association and increases lamin A/C phosphorylation at Ser 301, a characteristic of CAFs. Phosphorylated lamin A/C at Ser 301 binds to the regulatory region of CAF effector genes of the myofibroblast subtype. Expression of a lamin A/C Ser301 phosphomimetic mutant alone can transform normal fibroblasts into tumor-promoting CAFs.</span></p>',
			'date' => '2024-09-12',
			'pmid' => 'https://www.nature.com/articles/s41467-024-52344-z',
			'doi' => 'https://doi.org/10.1038/s41467-024-52344-z',
			'modified' => '2024-09-16 09:43:31',
			'created' => '2024-09-16 09:43:31',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 4 => array(
			'id' => '4970',
			'name' => 'A critical role for HNF4α in polymicrobial sepsis-associated metabolic reprogramming and death',
			'authors' => 'van Dender C. et al. ',
			'description' => '<p><span>In sepsis, limited food intake and increased energy expenditure induce a starvation response, which is compromised by a quick decline in the expression of hepatic PPAR&alpha;, a transcription factor essential in intracellular catabolism of free fatty acids. The mechanism upstream of this PPAR&alpha; downregulation is unknown. We found that sepsis causes a progressive hepatic loss-of-function of HNF4&alpha;, which has a strong impact on the expression of several important nuclear receptors, including PPAR&alpha;. HNF4&alpha; depletion in hepatocytes dramatically increases sepsis lethality, steatosis, and organ damage and prevents an adequate response to IL6, which is critical for liver regeneration and survival. An HNF4&alpha; agonist protects against sepsis at all levels, irrespectively of bacterial loads, suggesting HNF4&alpha; is crucial in tolerance to sepsis. In conclusion, hepatic HNF4&alpha; activity is decreased during sepsis, causing PPAR&alpha; downregulation, metabolic problems, and a disturbed IL6-mediated acute phase response. The findings provide new insights and therapeutic options in sepsis.</span></p>',
			'date' => '2024-09-11',
			'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/39261648/',
			'doi' => '10.1038/s44321-024-00130-1',
			'modified' => '2024-09-16 09:49:27',
			'created' => '2024-09-16 09:49:27',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 5 => array(
			'id' => '4926',
			'name' => 'High-throughput sequencing of insect specimens with sub-optimal DNA preservation using a practical, plate-based Illumina-compatible Tn5 transposase library preparation method',
			'authors' => 'Cobb L. et all.',
			'description' => '<p><span>Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, which often requires substantial DNA input amounts. Here, we use a practical Tn5 transposase tagmentation-based library preparation method optimised for 96-well plates and low yield DNA extracts from insect legs that were stored under sub-optimal conditions for DNA preservation. The samples were kept in field vehicles for extended periods of time, before long-term storage in ethanol in the freezer, or dry at room temperature. By reducing DNA input to 6ng, more samples with sub-optimal DNA yields could be processed. We matched this low DNA input with a 6-fold dilution of a commercially available tagmentation enzyme, significantly reducing library preparation costs. Costs and workload were further suppressed by direct post-amplification pooling of individual libraries. We generated medium coverage (&gt;3-fold) genomes for 88 out of 90 specimens, with an average of approximately 10-fold coverage. While samples stored in ethanol yielded significantly less DNA compared to those which were stored dry, these samples had superior sequencing statistics, with longer sequencing reads and higher rates of endogenous DNA. Furthermore, we find that the efficiency of tagmentation-based library preparation can be improved by a thorough post-amplification bead clean-up which selects against both short and large DNA fragments. By opening opportunities for the use of sub-optimally preserved, low yield DNA extracts, we broaden the scope of whole genome studies of insect specimens. We therefore expect these results and this protocol to be valuable for a range of applications in the field of entomology.</span></p>',
			'date' => '2024-03-22',
			'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38517905/',
			'doi' => '10.1371/journal.pone.0300865',
			'modified' => '2024-03-25 11:15:06',
			'created' => '2024-03-25 11:15:06',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 6 => array(
			'id' => '4923',
			'name' => 'On the identification of differentially-active transcription factors from ATAC-seq data',
			'authors' => 'Gerbaldo F. et al.',
			'description' => '<p><span>ATAC-seq has emerged as a rich epigenome profiling technique, and is commonly used to identify Transcription Factors (TFs) underlying given phenomena. A number of methods can be used to identify differentially-active TFs through the accessibility of their DNA-binding motif, however little is known on the best approaches for doing so. Here we benchmark several such methods using a combination of curated datasets with various forms of short-term perturbations on known TFs, as well as semi-simulations. We include both methods specifically designed for this type of data as well as some that can be repurposed for it. We also investigate variations to these methods, and identify three particularly promising approaches (chromVAR-limma with critical adjustments, monaLisa and a combination of GC smooth quantile normalization and multivariate modeling). We further investigate the specific use of nucleosome-free fragments, the combination of top methods, and the impact of technical variation. Finally, we illustrate the use of the top methods on a novel dataset to characterize the impact on DNA accessibility of TRAnscription Factor TArgeting Chimeras (TRAFTAC), which can deplete TFs &ndash; in our case NFkB &ndash; at the protein level.</span></p>',
			'date' => '2024-03-10',
			'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.03.06.583825v2',
			'doi' => 'https://doi.org/10.1101/2024.03.06.583825',
			'modified' => '2024-03-13 17:04:33',
			'created' => '2024-03-13 17:04:33',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 7 => array(
			'id' => '4918',
			'name' => 'Cellular reprogramming in vivo initiated by SOX4 pioneer factor activity',
			'authors' => 'Katsuda T.',
			'description' => '<p><span>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate &ldquo;reprogramming&rdquo; by opening new chromatin sites for expression that can attract transcription factors from the starting cell&rsquo;s enhancers. Here we report that SOX4 is sufficient to initiate hepatobiliary metaplasia in the adult mouse liver, closely mimicking metaplasia initiated by toxic damage to the liver. In lineage-traced cells, we assessed the timing of SOX4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, SOX4 directly binds to and closes hepatocyte regulatory sequences via an overlapping motif with HNF4A, a hepatocyte master regulatory transcription factor. Subsequently, SOX4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</span></p>',
			'date' => '2024-02-26',
			'pmid' => 'https://www.nature.com/articles/s41467-024-45939-z',
			'doi' => 'https://doi.org/10.1038/s41467-024-45939-z',
			'modified' => '2024-02-29 11:59:10',
			'created' => '2024-02-29 11:59:10',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 8 => array(
			'id' => '4889',
			'name' => 'The ncBAF complex regulates transcription in AML through H3K27ac sensing by BRD9',
			'authors' => 'Klein D.C. et al. ',
			'description' => '<p><span>The non-canonical BAF complex (ncBAF) subunit BRD9 is essential for acute myeloid leukemia (AML) cell viability but has an unclear role in leukemogenesis. Because BRD9 is required for ncBAF complex assembly through its DUF3512 domain, precise bromodomain inhibition is necessary to parse the role of BRD9 as a transcriptional regulator from that of a scaffolding protein. To understand the role of BRD9 bromodomain function in regulating AML, we selected a panel of five AML cell lines with distinct driver mutations, disease classifications, and genomic aberrations and subjected these cells to short-term BRD9 bromodomain inhibition. We examined the bromodomain-dependent growth of these cell lines, identifying a dependency in AML cell lines but not HEK293T cells. To define a mechanism through which BRD9 maintains AML cell survival, we examined nascent transcription, chromatin accessibility, and ncBAF complex binding genome-wide after bromodomain inhibition. We identified extensive regulation of transcription by BRD9 bromodomain activity, including repression of myeloid maturation factors and tumor suppressor genes, while standard AML chemotherapy targets were repressed by inhibition of the BRD9 bromodomain. BRD9 bromodomain activity maintained accessible chromatin at both gene promoters and gene-distal putative enhancer regions, in a manner that qualitatively correlated with enrichment of BRD9 binding. Furthermore, we identified reduced chromatin accessibility at GATA, ETS, and AP-1 motifs and increased chromatin accessibility at SNAIL-, HIC-, and TP53-recognized motifs after BRD9 inhibition. These data suggest a role for BRD9 in regulating AML cell differentiation through modulation of accessibility at hematopoietic transcription factor binding sites.</span></p>',
			'date' => '2023-12-21',
			'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38126767/',
			'doi' => '10.1158/2767-9764.CRC-23-0382',
			'modified' => '2024-01-02 11:07:14',
			'created' => '2024-01-02 11:07:14',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 9 => array(
			'id' => '4878',
			'name' => 'ARID1A governs the silencing of sex-linked transcription during male meiosis in the mouse',
			'authors' => 'Menon D.U. et al.',
			'description' => '<p><span>We present evidence implicating the BAF (BRG1/BRM Associated Factor) chromatin remodeler in meiotic sex chromosome inactivation (MSCI). By immunofluorescence (IF), the putative BAF DNA binding subunit, ARID1A (AT-rich Interaction Domain 1a), appeared enriched on the male sex chromosomes during diplonema of meiosis I. The germ cell-specific depletion of ARID1A resulted in a pachynema arrest and failure to repress sex-linked genes, indicating a defective MSCI. Consistent with this defect, mutant sex chromosomes displayed an abnormal presence of elongating RNA polymerase II coupled with an overall increase in chromatin accessibility detectable by ATAC-seq. By investigating potential mechanisms underlying these anomalies, we identified a role for ARID1A in promoting the preferential enrichment of the histone variant, H3.3, on the sex chromosomes, a known hallmark of MSCI. Without ARID1A, the sex chromosomes appeared depleted of H3.3 at levels resembling autosomes. Higher resolution analyses by CUT&amp;RUN revealed shifts in sex-linked H3.3 associations from discrete intergenic sites and broader gene-body domains to promoters in response to the loss of ARID1A. Several sex-linked sites displayed ectopic H3.3 occupancy that did not co-localize with DMC1 (DNA Meiotic Recombinase 1). This observation suggests a requirement for ARID1A in DMC1 localization to the asynapsed sex chromatids. We conclude that ARID1A-directed H3.3 localization influences meiotic sex chromosome gene regulation and DNA repair.</span></p>',
			'date' => '2023-09-28',
			'pmid' => 'https://www.biorxiv.org/content/10.1101/2023.05.25.542290v2.abstract',
			'doi' => 'https://doi.org/10.1101/2023.05.25.542290',
			'modified' => '2023-11-10 14:53:09',
			'created' => '2023-11-10 14:53:09',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 10 => array(
			'id' => '4825',
			'name' => 'Zfp296 knockout enhances chromatin accessibility and induces a uniquestate of pluripotency in embryonic stem cells.',
			'authors' => 'Miyazaki  S. et al.',
			'description' => '<p>The Zfp296 gene encodes a zinc finger-type protein. Its expression is high in mouse embryonic stem cells (ESCs) but rapidly decreases following differentiation. Zfp296-knockout (KO) ESCs grew as flat colonies, which were reverted to rounded colonies by exogenous expression of Zfp296. KO ESCs could not form teratomas when transplanted into mice but could efficiently contribute to germline-competent chimeric mice following blastocyst injection. Transcriptome analysis revealed that Zfp296 deficiency up- and down-regulates a distinct group of genes, among which Dppa3, Otx2, and Pou3f1 were markedly downregulated. Chromatin immunoprecipitation sequencing demonstrated that ZFP296 binding is predominantly seen in the vicinity of the transcription start sites (TSSs) of a number of genes, and ZFP296 was suggested to negatively regulate transcription. Consistently, chromatin accessibility assay clearly showed that ZFP296 binding reduces the accessibility of the TSS regions of target genes. Zfp296-KO ESCs showed increased histone H3K9 di- and trimethylation. Co-immunoprecipitation analyses revealed interaction of ZFP296 with G9a and GLP. These results show that ZFP296 plays essential roles in maintaining the global epigenetic state of ESCs through multiple mechanisms including activation of Dppa3, attenuation of chromatin accessibility, and repression of H3K9 methylation, but that Zfp296-KO ESCs retain a unique state of pluripotency while lacking the teratoma-forming ability.</p>',
			'date' => '2023-07-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37488353',
			'doi' => '10.1038/s42003-023-05148-8',
			'modified' => '2023-08-01 13:30:58',
			'created' => '2023-08-01 15:59:38',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 11 => array(
			'id' => '4817',
			'name' => 'YAP/BRD4-controlled ROR1 promotes tumor-initiating cells andhyperproliferation in pancreatic cancer.',
			'authors' => 'Yamazaki  M. et al.',
			'description' => '<p><span>Tumor-initiating cells are major drivers of chemoresistance and attractive targets for cancer therapy, however, their identity in human pancreatic ductal adenocarcinoma (PDAC) and the key molecules underlying their traits remain poorly understood. Here, we show that a cellular subpopulation with partial epithelial-mesenchymal transition (EMT)-like signature marked by high expression of receptor tyrosine kinase-like orphan receptor 1 (ROR1) is the origin of heterogeneous tumor cells in PDAC. We demonstrate that ROR1 depletion suppresses tumor growth, recurrence after chemotherapy, and metastasis. Mechanistically, ROR1 induces the expression of Aurora kinase B (AURKB) by activating E2F through c-Myc to enhance PDAC proliferation. Furthermore, epigenomic analyses reveal that ROR1 is transcriptionally dependent on YAP/BRD4 binding at the enhancer region, and targeting this pathway reduces ROR1 expression and prevents PDAC growth. Collectively, our findings reveal a critical role for ROR1high cells as tumor-initiating cells and the functional importance of ROR1 in PDAC progression, thereby highlighting its therapeutic targetability.</span></p>',
			'date' => '2023-04-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37096681',
			'doi' => '10.15252/embj.2022112614',
			'modified' => '2023-06-15 10:06:12',
			'created' => '2023-06-13 21:11:31',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 12 => array(
			'id' => '4757',
			'name' => 'Analyzing genomic and epigenetic profiles in single cells by hybridtransposase (scGET-seq).',
			'authors' => 'Cittaro  D. et al.',
			'description' => '<p>scGET-seq simultaneously profiles euchromatin and heterochromatin. scGET-seq exploits the concurrent action of transposase Tn5 and its hybrid form TnH, which targets H3K9me3 domains. Here we present a step-by-step protocol to profile single cells by scGET-seq using a 10&Atilde;&mdash; Chromium Controller. We describe steps for transposomes preparation and validation. We detail nuclei preparation and transposition, followed by encapsulation, library preparation, sequencing, and data analysis. For complete details on the use and execution of this protocol, please refer to Tedesco et&Acirc;&nbsp;al. (2022) and de Pretis and Cittaro (2022)..</p>',
			'date' => '2023-03-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37000619',
			'doi' => '10.1016/j.xpro.2023.102176',
			'modified' => '2023-04-17 09:04:55',
			'created' => '2023-04-14 13:41:22',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 13 => array(
			'id' => '4742',
			'name' => 'A neurodevelopmental epigenetic programme mediated bySMARCD3-DAB1-Reelin signalling is hijacked to promote medulloblastomametastasis.',
			'authors' => 'Zou  Han et al.',
			'description' => '<p>How abnormal neurodevelopment relates to the tumour aggressiveness of medulloblastoma (MB), the most common type of embryonal tumour, remains elusive. Here we uncover a neurodevelopmental epigenomic programme that is hijacked to induce MB metastatic dissemination. Unsupervised analyses of integrated publicly available datasets with our newly generated data reveal that SMARCD3 (also known as BAF60C) regulates Disabled&acirc;&euro;&permil;1 (DAB1)-mediated Reelin signalling in Purkinje cell migration and MB metastasis by orchestrating cis-regulatory elements at the DAB1 locus. We further identify that a core set of transcription factors, enhancer of zeste homologue&acirc;&euro;&permil;2 (EZH2) and nuclear factor&acirc;&euro;&permil;I&acirc;&euro;&permil;X (NFIX), coordinates with the cis-regulatory elements at the SMARCD3 locus to form a chromatin hub to control SMARCD3 expression in the developing cerebellum and in metastatic MB. Increased SMARCD3 expression activates Reelin-DAB1-mediated Src kinase signalling, which results in a MB response to Src inhibition. These data deepen our understanding of how neurodevelopmental programming influences disease progression and provide a potential therapeutic option for patients with MB.</p>',
			'date' => '2023-02-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/36849558',
			'doi' => '10.1038/s41556-023-01093-0',
			'modified' => '2023-03-14 09:41:24',
			'created' => '2023-03-02 17:27:08',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 14 => array(
			'id' => '4568',
			'name' => 'Physiological reprogramming in vivo mediated by Sox4 pioneer factoractivity',
			'authors' => 'Katsuda  T. et al.',
			'description' => '<p>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate &ldquo;reprogramming&rdquo; by opening new chromatin sites for expression that can attract transcription factors from the starting cell&rsquo;s enhancers. Here we report that Sox4 is sufficient to initiate hepatobiliary metaplasia in the adult liver. In lineage-traced cells, we assessed the timing of Sox4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, Sox4 directly binds to and closes hepatocyte regulatory sequences via a motif it overlaps with Hnf4a, a hepatocyte master regulator. Subsequently, Sox4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</p>',
			'date' => '2023-01-01',
			'pmid' => 'https://doi.org/10.1101%2F2023.02.14.528556',
			'doi' => '10.1101/2023.02.14.528556',
			'modified' => '2023-04-11 10:26:02',
			'created' => '2023-02-21 09:59:46',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 15 => array(
			'id' => '4660',
			'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
			'authors' => 'Zolotarev  Nikolay et al.',
			'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to na&iuml;ve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
			'date' => '2022-11-01',
			'pmid' => 'https://doi.org/10.1073%2Fpnas',
			'doi' => '10.1073/pnas.2210595119',
			'modified' => '2023-03-07 09:07:41',
			'created' => '2023-02-21 09:59:46',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		)
	),
	'Testimonial' => array(
		(int) 0 => array(
			'id' => '82',
			'name' => 'Tagmentase',
			'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
			'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
			'featured' => true,
			'slug' => 'testimonial-tagmentase',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2023-02-08 09:40:13',
			'created' => '2023-02-08 09:37:00',
			'ProductsTestimonial' => array(
				[maximum depth reached]
			)
		)
	),
	'Area' => array(),
	'SafetySheet' => array(
		(int) 0 => array(
			'id' => '2128',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS US en',
			'language' => 'en',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-US-en-GHS_1_0.pdf',
			'countries' => 'US',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 1 => array(
			'id' => '2126',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS GB en',
			'language' => 'en',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-GB-en-GHS_1_0.pdf',
			'countries' => 'GB',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 2 => array(
			'id' => '2121',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS BE fr',
			'language' => 'fr',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-BE-fr-GHS_1_0.pdf',
			'countries' => 'BE',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 3 => array(
			'id' => '2125',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS FR fr',
			'language' => 'fr',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-FR-fr-GHS_1_0.pdf',
			'countries' => 'FR',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 4 => array(
			'id' => '2124',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS ES es',
			'language' => 'es',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-ES-es-GHS_1_0.pdf',
			'countries' => 'ES',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 5 => array(
			'id' => '2123',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS DE de',
			'language' => 'de',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-DE-de-GHS_1_0.pdf',
			'countries' => 'DE',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 6 => array(
			'id' => '2127',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS JP ja',
			'language' => 'ja',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-JP-ja-GHS_2_0.pdf',
			'countries' => 'JP',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 7 => array(
			'id' => '2122',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS BE nl',
			'language' => 'nl',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-BE-nl-GHS_1_0.pdf',
			'countries' => 'BE',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		)
	)
)
$meta_canonical = 'https://www.diagenode.com/cn/p/tagmentase-loaded-30'
$country = 'US'
$countries_allowed = array(
	(int) 0 => 'CA',
	(int) 1 => 'US',
	(int) 2 => 'IE',
	(int) 3 => 'GB',
	(int) 4 => 'DK',
	(int) 5 => 'NO',
	(int) 6 => 'SE',
	(int) 7 => 'FI',
	(int) 8 => 'NL',
	(int) 9 => 'BE',
	(int) 10 => 'LU',
	(int) 11 => 'FR',
	(int) 12 => 'DE',
	(int) 13 => 'CH',
	(int) 14 => 'AT',
	(int) 15 => 'ES',
	(int) 16 => 'IT',
	(int) 17 => 'PT'
)
$outsource = true
$other_formats = array(
	(int) 0 => array(
		'id' => '3164',
		'antibody_id' => null,
		'name' => 'Tagmentase (Tn5 transposase) - loaded',
		'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns">
<p>&nbsp;</p>
<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
		'label1' => 'Examples of results',
		'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label2' => 'Product information',
		'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span> 3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span> correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions: </strong>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong> Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong> Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div>ATAC-seq package for tissue, Cat. No.&nbsp;<span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label3' => '',
		'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'format' => '30 μl',
		'catalog_number' => 'C01070012-30',
		'old_catalog_number' => '',
		'sf_code' => 'C01070012-143301',
		'type' => 'FRE',
		'search_order' => '',
		'price_EUR' => '330',
		'price_USD' => '330',
		'price_GBP' => '300',
		'price_JPY' => '51695',
		'price_CNY' => '',
		'price_AUD' => '825',
		'country' => 'ALL',
		'except_countries' => 'None',
		'quote' => false,
		'in_stock' => false,
		'featured' => true,
		'no_promo' => false,
		'online' => true,
		'master' => true,
		'last_datasheet_update' => '',
		'slug' => 'tagmentase-loaded-30',
		'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 30 | Diagenode',
		'meta_keywords' => '',
		'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
		'modified' => '2024-09-13 15:36:59',
		'created' => '2020-12-08 16:15:40'
	),
	(int) 1 => array(
		'id' => '3205',
		'antibody_id' => null,
		'name' => 'Tagmentase (Tn5 transposase) - loaded',
		'description' => '<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
		'label1' => 'Examples of results',
		'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label2' => 'Product information',
		'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span><span>&nbsp;</span>3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span><span>&nbsp;</span>correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions:</strong><span>&nbsp;</span>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong><span>&nbsp;</span>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage:&nbsp;</strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong><span>&nbsp;</span>Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div><span>ATAC-seq package for tissue, Cat. No.&nbsp;</span><span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label3' => '',
		'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'format' => '200 μl',
		'catalog_number' => 'C01070012-200',
		'old_catalog_number' => '',
		'sf_code' => 'C01070012-93190',
		'type' => 'FRE',
		'search_order' => '',
		'price_EUR' => '2090',
		'price_USD' => '2090',
		'price_GBP' => '1800',
		'price_JPY' => '327400',
		'price_CNY' => '0',
		'price_AUD' => '5225',
		'country' => 'ALL',
		'except_countries' => 'None',
		'quote' => true,
		'in_stock' => false,
		'featured' => false,
		'no_promo' => false,
		'online' => true,
		'master' => false,
		'last_datasheet_update' => '',
		'slug' => 'tagmentase-loaded-200',
		'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Diagenode',
		'meta_keywords' => '',
		'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
		'modified' => '2024-09-13 15:37:53',
		'created' => '2021-10-21 11:35:59',
		'ProductsGroup' => array(
			'id' => '400',
			'product_id' => '3205',
			'group_id' => '331'
		)
	)
)
$pro = array(
	'id' => '3205',
	'antibody_id' => null,
	'name' => 'Tagmentase (Tn5 transposase) - loaded',
	'description' => '<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
	'label1' => 'Examples of results',
	'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label2' => 'Product information',
	'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span><span>&nbsp;</span>3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span><span>&nbsp;</span>correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions:</strong><span>&nbsp;</span>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong><span>&nbsp;</span>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage:&nbsp;</strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong><span>&nbsp;</span>Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div><span>ATAC-seq package for tissue, Cat. No.&nbsp;</span><span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label3' => '',
	'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'format' => '200 μl',
	'catalog_number' => 'C01070012-200',
	'old_catalog_number' => '',
	'sf_code' => 'C01070012-93190',
	'type' => 'FRE',
	'search_order' => '',
	'price_EUR' => '2090',
	'price_USD' => '2090',
	'price_GBP' => '1800',
	'price_JPY' => '327400',
	'price_CNY' => '0',
	'price_AUD' => '5225',
	'country' => 'ALL',
	'except_countries' => 'None',
	'quote' => true,
	'in_stock' => false,
	'featured' => false,
	'no_promo' => false,
	'online' => true,
	'master' => false,
	'last_datasheet_update' => '',
	'slug' => 'tagmentase-loaded-200',
	'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Diagenode',
	'meta_keywords' => '',
	'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
	'modified' => '2024-09-13 15:37:53',
	'created' => '2021-10-21 11:35:59',
	'ProductsGroup' => array(
		'id' => '400',
		'product_id' => '3205',
		'group_id' => '331'
	)
)
$edit = ''
$testimonials = ''
$featured_testimonials = '<blockquote><span class="label-green" style="margin-bottom:16px;margin-left:-22px">TESTIMONIAL</span><p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p><cite>Julia Liz Touza, AstraZeneca Gothenburg, Sweden</cite></blockquote>
'
$testimonial = array(
	'id' => '82',
	'name' => 'Tagmentase',
	'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
	'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
	'featured' => true,
	'slug' => 'testimonial-tagmentase',
	'meta_keywords' => '',
	'meta_description' => '',
	'modified' => '2023-02-08 09:40:13',
	'created' => '2023-02-08 09:37:00',
	'ProductsTestimonial' => array(
		'id' => '200',
		'product_id' => '3165',
		'testimonial_id' => '82'
	)
)
$related_products = '<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/tagmentation-buffer-2x"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01019043</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3162" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3162" id="CartAdd/3162Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3162" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> Tagmentation Buffer (2x)</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
                    'C01019043',
                     '100',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
                    'C01019043',
                    '100',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="tagmentation-buffer-2x" data-reveal-id="cartModal-3162" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">Tagmentation Buffer (2x)</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/24-unique-dual-indexes-for-tagmented-libraries-set1"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01011034</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3158" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3158" id="CartAdd/3158Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3158" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for Tagmented libraries - Set I</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
                    'C01011034',
                     '185',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
                    'C01011034',
                    '185',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set1" data-reveal-id="cartModal-3158" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">24 UDI for Tagmented libraries - Set I</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/atac-seq-kit-24rxns"><img src="/img/product/kits/atacseq-kit-picture.jpg" alt="ATAC-seq kit" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01080002</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3194" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3194" id="CartAdd/3194Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3194" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ATAC-seq kit</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq kit',
                    'C01080002',
                     '1745',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq kit',
                    'C01080002',
                    '1745',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="atac-seq-kit-24rxns" data-reveal-id="cartModal-3194" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">ATAC-seq kit</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/ATAC-seq-package-tissue-C01080006"><img src="/img/grey-logo.jpg" alt="default alt" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01080006</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3215" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3215" id="CartAdd/3215Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3215" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ATAC-seq package for tissue</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
                    'C01080006',
                     '2050',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
                    'C01080006',
                    '2050',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="ATAC-seq-package-tissue-C01080006" data-reveal-id="cartModal-3215" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">ATAC-seq package for tissue</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/tagmentase"><img src="https://www.diagenode.com/img/product/kits/tag-unloaded.png" alt="Tubes" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01070010-10</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3057" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3057" id="CartAdd/3057Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3057" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> Tagmentase (Tn5 transposase) - unloaded</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentase (Tn5 transposase) - unloaded',
                    'C01070010-10',
                     '355',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentase (Tn5 transposase) - unloaded',
                    'C01070010-10',
                    '355',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="tagmentase" data-reveal-id="cartModal-3057" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">Tagmentase</h6>
        </div>

    </div>
</li>
'
$related = array(
	'id' => '3057',
	'antibody_id' => null,
	'name' => 'Tagmentase (Tn5 transposase) - unloaded',
	'description' => '<div class="extra-spaced"><center><img alt="Tagmentase (Tn5 transposase)" src="https://www.diagenode.com/img/banners/banner-tagmentase.jpg" caption="false" width="787" height="236" /></center></div>
<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode Tagmentase is a hyperactive Tn5 transposase with the potential to enhance epigenetic studies. Its ability to cut DNA and insert sequences of interest in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq, ChIPmentation, CHANGE-seq and other. The enzyme is not loaded with DNA oligos, providing flexibility of application. To ensure optimal results the concentration may be adjusted with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> (Cat. No. C01070011), available separately.</p>
<p><a href="https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf" target="_blank">Protocol for transposome assembly</a></p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) you may also need:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for loaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) - loaded</a>.</p>',
	'label1' => 'Quality control',
	'info1' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><img alt="Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1a.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="653" height="282" /></p>
<p><img alt="Tagmentase Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1b.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="645" height="278" /></p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 1: Efficient fragmentation of the lambda DNA after incubation with the Tagmentase</strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with diluted Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). Profiles show the size of lambda DNA before (A) and after treatment with Tagmentase (B).</p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns"><center><img alt="Tn5 transposase perfect for NGS" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure2.jpg" width="754" height="492" /></center></div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 2: Fragmentation efficiency depending on the amount of Tagmentase </strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The Tagmentase was previously diluted with the Tagmentase Dilution Buffer (Cat. No.) at &frac14; and 1/16 dilutions. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). The migration of the samples shows variations of the size distribution according to the amount of Tagmentase used for the reaction.</p>
</div>
</div>',
	'label2' => 'Product information',
	'info2' => '<p><strong>Tagmentase (Tn5 transposase) - unloaded</strong></p>
<div><span style="font-family: inherit;">Protein Molecular weight: 53.3 kDa</span></div>
<p>Expressed: in Escherichia coli</p>
<p><strong>Product description:</strong> Diagenode Tagmentase &ndash; unloaded is a hyperactive Tn5 transposase. The enzyme catalyzes &ldquo;cut and paste&rdquo; tagmentation reaction and can be used to insert any target DNA in vitro.</p>
<p><strong>Storage conditions:</strong> Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer: </strong>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>The enzyme should be loaded with appropriate oligonucleotides prior to use. An efficient transposition require that insert DNA have a specific 19-bp transposase recognition sequence (Mosaic End or ME sequence) at each of its ends. The transposome assembly protocol can be found at https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications: </strong>Tagmentase (Tn5 transposase) &ndash; unloaded can be used in a variety of applications including transgenic experiments, barcoding and library construction for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label3' => '',
	'info3' => '<p></p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'format' => '10 µl',
	'catalog_number' => 'C01070010-10',
	'old_catalog_number' => '',
	'sf_code' => 'C01070010-19650',
	'type' => 'FRE',
	'search_order' => '',
	'price_EUR' => '355',
	'price_USD' => '355',
	'price_GBP' => '320',
	'price_JPY' => '55610',
	'price_CNY' => '0',
	'price_AUD' => '888',
	'country' => 'ALL',
	'except_countries' => 'None',
	'quote' => false,
	'in_stock' => false,
	'featured' => false,
	'no_promo' => false,
	'online' => true,
	'master' => true,
	'last_datasheet_update' => '',
	'slug' => 'tagmentase',
	'meta_title' => 'Tagmentase (Tn5 transposase) -unloaded | Diagenode',
	'meta_keywords' => '',
	'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. The enzyme is not loaded with DNA oligos, providing flexibility of application.',
	'modified' => '2024-09-13 15:48:15',
	'created' => '2020-03-24 17:33:04',
	'ProductsRelated' => array(
		'id' => '4923',
		'product_id' => '3165',
		'related_id' => '3057'
	),
	'Image' => array(
		(int) 0 => array(
			'id' => '1828',
			'name' => 'https://www.diagenode.com/img/product/kits/tag-unloaded.png',
			'alt' => 'Tubes',
			'modified' => '2024-03-28 17:29:30',
			'created' => '2024-03-28 17:29:30',
			'ProductsImage' => array(
				[maximum depth reached]
			)
		)
	)
)
$rrbs_service = array(
	(int) 0 => (int) 1894,
	(int) 1 => (int) 1895
)
$chipseq_service = array(
	(int) 0 => (int) 2683,
	(int) 1 => (int) 1835,
	(int) 2 => (int) 1836,
	(int) 3 => (int) 2684,
	(int) 4 => (int) 1838,
	(int) 5 => (int) 1839,
	(int) 6 => (int) 1856
)
$labelize = object(Closure) {
	
}
$old_catalog_number = ''
$country_code = 'US'
$other_format = array(
	'id' => '3205',
	'antibody_id' => null,
	'name' => 'Tagmentase (Tn5 transposase) - loaded',
	'description' => '<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
	'label1' => 'Examples of results',
	'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label2' => 'Product information',
	'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span><span>&nbsp;</span>3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span><span>&nbsp;</span>correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions:</strong><span>&nbsp;</span>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong><span>&nbsp;</span>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage:&nbsp;</strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong><span>&nbsp;</span>Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div><span>ATAC-seq package for tissue, Cat. No.&nbsp;</span><span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label3' => '',
	'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'format' => '200 μl',
	'catalog_number' => 'C01070012-200',
	'old_catalog_number' => '',
	'sf_code' => 'C01070012-93190',
	'type' => 'FRE',
	'search_order' => '',
	'price_EUR' => '2090',
	'price_USD' => '2090',
	'price_GBP' => '1800',
	'price_JPY' => '327400',
	'price_CNY' => '0',
	'price_AUD' => '5225',
	'country' => 'ALL',
	'except_countries' => 'None',
	'quote' => true,
	'in_stock' => false,
	'featured' => false,
	'no_promo' => false,
	'online' => true,
	'master' => false,
	'last_datasheet_update' => '',
	'slug' => 'tagmentase-loaded-200',
	'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Diagenode',
	'meta_keywords' => '',
	'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
	'modified' => '2024-09-13 15:37:53',
	'created' => '2021-10-21 11:35:59',
	'ProductsGroup' => array(
		'id' => '400',
		'product_id' => '3205',
		'group_id' => '331'
	)
)
$label = '<img src="/img/banners/banner-customizer-back.png" alt=""/>'
$document = array(
	'id' => '1116',
	'name' => 'Datasheet Tagmentase loaded C01070012',
	'description' => '',
	'image_id' => null,
	'type' => 'Datasheet',
	'url' => 'files/products/kits/Datasheet_Tagmentase_loaded_C01070012.pdf',
	'slug' => 'tagmentase-loaded-30-datasheet',
	'meta_keywords' => '',
	'meta_description' => '',
	'modified' => '2020-12-10 17:04:06',
	'created' => '2020-12-10 17:04:06',
	'ProductsDocument' => array(
		'id' => '3059',
		'product_id' => '3165',
		'document_id' => '1116'
	)
)
$sds = array(
	'id' => '2122',
	'name' => 'Tagmentase (Tn5 transposase) - loaded SDS BE nl',
	'language' => 'nl',
	'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-BE-nl-GHS_1_0.pdf',
	'countries' => 'BE',
	'modified' => '2021-10-12 14:34:34',
	'created' => '2021-10-12 14:34:34',
	'ProductsSafetySheet' => array(
		'id' => '3675',
		'product_id' => '3165',
		'safety_sheet_id' => '2122'
	)
)
$publication = array(
	'id' => '4660',
	'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
	'authors' => 'Zolotarev  Nikolay et al.',
	'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to na&iuml;ve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
	'date' => '2022-11-01',
	'pmid' => 'https://doi.org/10.1073%2Fpnas',
	'doi' => '10.1073/pnas.2210595119',
	'modified' => '2023-03-07 09:07:41',
	'created' => '2023-02-21 09:59:46',
	'ProductsPublication' => array(
		'id' => '6552',
		'product_id' => '3165',
		'publication_id' => '4660'
	)
)
$externalLink = ' <a href="https://doi.org/10.1073%2Fpnas" target="_blank"><i class="fa fa-external-link"></i></a>'
include - APP/View/Products/view.ctp, line 755
View::_evaluate() - CORE/Cake/View/View.php, line 971
View::_render() - CORE/Cake/View/View.php, line 933
View::render() - CORE/Cake/View/View.php, line 473
Controller::render() - CORE/Cake/Controller/Controller.php, line 963
ProductsController::slug() - APP/Controller/ProductsController.php, line 1052
ReflectionMethod::invokeArgs() - [internal], line ??
Controller::invokeAction() - CORE/Cake/Controller/Controller.php, line 491
Dispatcher::_invoke() - CORE/Cake/Routing/Dispatcher.php, line 193
Dispatcher::dispatch() - CORE/Cake/Routing/Dispatcher.php, line 167
[main] - APP/webroot/index.php, line 118

Notice (8): Undefined variable: campaign_id [APP/View/Products/view.ctp, line 755]Code Context<!-- BEGIN: REQUEST_FORM MODAL -->
<div id="request_formModal" class="reveal-modal medium" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
    <?= $this->element('Forms/simple_form', array('solution_of_interest' => $solution_of_interest, 'header' => $header, 'message' => $message, 'campaign_id' => $campaign_id)) ?>
$viewFile = '/home/website-server/www/app/View/Products/view.ctp'
$dataForView = array(
	'language' => 'cn',
	'meta_keywords' => '',
	'meta_description' => '',
	'meta_title' => 'Tagmentase - loaded - 10',
	'product' => array(
		'Product' => array(
			'id' => '3165',
			'antibody_id' => null,
			'name' => 'Tagmentase (Tn5 transposase) – loaded EARLY ACCESS',
			'description' => '',
			'label1' => '',
			'info1' => '',
			'label2' => '',
			'info2' => '',
			'label3' => '',
			'info3' => '',
			'format' => '10 µl',
			'catalog_number' => 'C01070012-10',
			'old_catalog_number' => '',
			'sf_code' => 'C01070012-19650',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '120',
			'price_USD' => '120',
			'price_GBP' => '115',
			'price_JPY' => '18800',
			'price_CNY' => '',
			'price_AUD' => '300',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => false,
			'last_datasheet_update' => '',
			'slug' => 'tagmentase-loaded-10',
			'meta_title' => 'Tagmentase - loaded - 10',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2024-09-13 14:26:44',
			'created' => '2020-12-08 16:17:54',
			'locale' => 'zho'
		),
		'Antibody' => array(
			'host' => '*****',
			'id' => null,
			'name' => null,
			'description' => null,
			'clonality' => null,
			'isotype' => null,
			'lot' => null,
			'concentration' => null,
			'reactivity' => null,
			'type' => null,
			'purity' => null,
			'classification' => null,
			'application_table' => null,
			'storage_conditions' => null,
			'storage_buffer' => null,
			'precautions' => null,
			'uniprot_acc' => null,
			'slug' => null,
			'meta_keywords' => null,
			'meta_description' => null,
			'modified' => null,
			'created' => null,
			'select_label' => null
		),
		'Slave' => array(),
		'Group' => array(
			'Group' => array(
				[maximum depth reached]
			),
			'Master' => array(
				[maximum depth reached]
			),
			'Product' => array(
				[maximum depth reached]
			)
		),
		'Related' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			),
			(int) 2 => array(
				[maximum depth reached]
			),
			(int) 3 => array(
				[maximum depth reached]
			),
			(int) 4 => array(
				[maximum depth reached]
			)
		),
		'Application' => array(),
		'Category' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Document' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Feature' => array(),
		'Image' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Promotion' => array(),
		'Protocol' => array(),
		'Publication' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			),
			(int) 2 => array(
				[maximum depth reached]
			),
			(int) 3 => array(
				[maximum depth reached]
			),
			(int) 4 => array(
				[maximum depth reached]
			),
			(int) 5 => array(
				[maximum depth reached]
			),
			(int) 6 => array(
				[maximum depth reached]
			),
			(int) 7 => array(
				[maximum depth reached]
			),
			(int) 8 => array(
				[maximum depth reached]
			),
			(int) 9 => array(
				[maximum depth reached]
			),
			(int) 10 => array(
				[maximum depth reached]
			),
			(int) 11 => array(
				[maximum depth reached]
			),
			(int) 12 => array(
				[maximum depth reached]
			),
			(int) 13 => array(
				[maximum depth reached]
			),
			(int) 14 => array(
				[maximum depth reached]
			),
			(int) 15 => array(
				[maximum depth reached]
			)
		),
		'Testimonial' => array(
			(int) 0 => array(
				[maximum depth reached]
			)
		),
		'Area' => array(),
		'SafetySheet' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			),
			(int) 2 => array(
				[maximum depth reached]
			),
			(int) 3 => array(
				[maximum depth reached]
			),
			(int) 4 => array(
				[maximum depth reached]
			),
			(int) 5 => array(
				[maximum depth reached]
			),
			(int) 6 => array(
				[maximum depth reached]
			),
			(int) 7 => array(
				[maximum depth reached]
			)
		)
	),
	'meta_canonical' => 'https://www.diagenode.com/cn/p/tagmentase-loaded-30'
)
$language = 'cn'
$meta_keywords = ''
$meta_description = ''
$meta_title = 'Tagmentase - loaded - 10'
$product = array(
	'Product' => array(
		'id' => '3165',
		'antibody_id' => null,
		'name' => 'Tagmentase (Tn5 transposase) – loaded EARLY ACCESS',
		'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns">
<p>&nbsp;</p>
<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
		'label1' => 'Examples of results',
		'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label2' => 'Product information',
		'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span> 3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span> correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions: </strong>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong> Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong> Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div>ATAC-seq package for tissue, Cat. No.&nbsp;<span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label3' => '',
		'info3' => '',
		'format' => '10 µl',
		'catalog_number' => 'C01070012-10',
		'old_catalog_number' => '',
		'sf_code' => 'C01070012-19650',
		'type' => 'FRE',
		'search_order' => '',
		'price_EUR' => '120',
		'price_USD' => '120',
		'price_GBP' => '115',
		'price_JPY' => '18800',
		'price_CNY' => '',
		'price_AUD' => '300',
		'country' => 'ALL',
		'except_countries' => 'None',
		'quote' => false,
		'in_stock' => false,
		'featured' => false,
		'no_promo' => false,
		'online' => true,
		'master' => false,
		'last_datasheet_update' => '',
		'slug' => 'tagmentase-loaded-10',
		'meta_title' => 'Tagmentase - loaded - 10',
		'meta_keywords' => '',
		'meta_description' => '',
		'modified' => '2024-09-13 14:26:44',
		'created' => '2020-12-08 16:17:54',
		'locale' => 'zho'
	),
	'Antibody' => array(
		'host' => '*****',
		'id' => null,
		'name' => null,
		'description' => null,
		'clonality' => null,
		'isotype' => null,
		'lot' => null,
		'concentration' => null,
		'reactivity' => null,
		'type' => null,
		'purity' => null,
		'classification' => null,
		'application_table' => null,
		'storage_conditions' => null,
		'storage_buffer' => null,
		'precautions' => null,
		'uniprot_acc' => null,
		'slug' => null,
		'meta_keywords' => null,
		'meta_description' => null,
		'modified' => null,
		'created' => null,
		'select_label' => null
	),
	'Slave' => array(),
	'Group' => array(
		'Group' => array(
			'id' => '331',
			'name' => 'C01070012',
			'product_id' => '3164',
			'modified' => '2020-12-08 16:19:24',
			'created' => '2020-12-08 16:19:24'
		),
		'Master' => array(
			'id' => '3164',
			'antibody_id' => null,
			'name' => 'Tagmentase (Tn5 transposase) - loaded',
			'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns">
<p>&nbsp;</p>
<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
			'label1' => 'Examples of results',
			'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => 'Product information',
			'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span> 3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span> correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions: </strong>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong> Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong> Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div>ATAC-seq package for tissue, Cat. No.&nbsp;<span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '30 μl',
			'catalog_number' => 'C01070012-30',
			'old_catalog_number' => '',
			'sf_code' => 'C01070012-143301',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '330',
			'price_USD' => '330',
			'price_GBP' => '300',
			'price_JPY' => '51695',
			'price_CNY' => '',
			'price_AUD' => '825',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => true,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'tagmentase-loaded-30',
			'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 30 | Diagenode',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
			'modified' => '2024-09-13 15:36:59',
			'created' => '2020-12-08 16:15:40'
		),
		'Product' => array(
			(int) 0 => array(
				[maximum depth reached]
			),
			(int) 1 => array(
				[maximum depth reached]
			)
		)
	),
	'Related' => array(
		(int) 0 => array(
			'id' => '3162',
			'antibody_id' => null,
			'name' => 'Tagmentation Buffer (2x)',
			'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode <strong>Tagmentation Buffer (2x)</strong> is the recommended reagent to perform any tagmentation reactions. It can be used in combination with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase)</a> on DNA or chromatin samples, as half of the total volume reaction like in ATAC-seq protocol.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
 var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); } 
// ]]></script>
</center></div>
</div>
<p></p>',
			'label1' => 'Examples of use',
			'info1' => '<p><span style="text-decoration: underline;">ATAC-seq experiments: </span></p>
<ul style="list-style-type: circle;">
<li>After cell lysis and nuclei isolation, the nuclei pellets can be incubated with the following mix for 1 reaction:</li>
</ul>
<table style="width: 447px;">
<tbody>
<tr>
<td style="width: 326px;">Tagmentation Buffer (2x)</td>
<td style="width: 114px; padding-left: 30px;">25 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Tagmentase loaded</td>
<td style="width: 114px; padding-left: 30px;">2.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;"><span>Digitonin 1%</span></td>
<td style="width: 114px; padding-left: 30px;">0.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Tween20 10%</td>
<td style="width: 114px; padding-left: 30px;">0.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">PBS</td>
<td style="width: 114px; padding-left: 30px;">16.5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Nuclease-free water</td>
<td style="width: 114px; padding-left: 30px;">&nbsp;5 &micro;l</td>
</tr>
<tr>
<td style="width: 326px;">Nuclei pellet*</td>
<td style="width: 114px;"></td>
</tr>
</tbody>
</table>
<p><em>*&nbsp; The number of nuclei per reaction will depend on the ATAC-seq experimental design. Successful tagmentation with the proposed protocol has been performed on 50,000 nuclei per reaction.&nbsp;</em></p>
<ul style="list-style-type: circle;">
<li>The reaction is then incubated 30 minutes at 37&deg;C.</li>
<li>The tagmentation reaction can then be stopped by addition of 250 &micro;l of DNA Binding buffer from Diagenode MicroChIP DiaPure Columns (Cat. No. C03040001).</li>
<li>The tagmented libraries can then be purified using the MicroChIP DiaPure Columns (Cat. No. C03040001), and amplified.</li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => '',
			'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '300 µl ',
			'catalog_number' => 'C01019043',
			'old_catalog_number' => '',
			'sf_code' => 'C01019043-29421',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '90',
			'price_USD' => '100',
			'price_GBP' => '105',
			'price_JPY' => '14100',
			'price_CNY' => '',
			'price_AUD' => '250',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'tagmentation-buffer-2x',
			'meta_title' => 'Tagmentation Buffer 2x',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2023-06-20 18:19:03',
			'created' => '2020-12-08 16:00:14',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		),
		(int) 1 => array(
			'id' => '3158',
			'antibody_id' => null,
			'name' => '24 UDI for Tagmented libraries - Set I',
			'description' => '<p><a href="https://www.diagenode.com/files/products/kits/primer-indexes-for-tagmented-libraries_manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p>The <strong>24 UDI for tagmented libraries</strong> includes 24 primer pairs for unique dual-indexing allowing the multiplexing of up to <b>24 samples </b>for sequencing on Illumina platforms. These UDI are designed and validated to be used with <a href="https://www.diagenode.com/en/p/uchipmentation-for-histones-24-rxns">&mu;ChIPmentation for Histones</a> (Cat. No. C01011011), <a href="https://www.diagenode.com/en/p/chipmentation-kit-for-histones">ChIPmentation Kit for Histones</a> (Cat. No. C01011009), <a href="https://www.diagenode.com/en/p/tag-kit-for-chipmentation-24">TAG Kit for ChIPmentation</a> (Cat. No. C01011030), <a href="https://www.diagenode.com/en/categories/atac-seq">ATAC-seq Kit</a> (Cat. No. C01080002). The 24 UDI for tagmented libraries are compatible with other <b>tagmentation</b><b>-based library preparation </b>protocols, such as <a href="https://www.diagenode.com/en/categories/cutandtag">CUT&amp;Tag</a> technologies.</p>
<p>3 sets of UDI for tagmented libraries are available:</p>
<p><strong>24 UDI for tagmented libraries - Set I</strong><br /> <a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set2">24 UDI for tagmented libraries - Set II</a><br /><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set3" target="_blank">24 UDI for tagmented libraries -&nbsp; Set III</a><br /><br /></p>
<p><span>Each set can be used for library multiplexing up to 24. All sets can be used simultaneously for library multiplexing up to 72.</span></p>
<p>Features:</p>
<ul>
<li>Multiplexing: <b>up to 72 samples&nbsp;</b>(using all 3 sets simultaneously)<b><br /></b></li>
<li>Allow for <b>identification of index hopping</b></li>
<li>Compatibility: <b>tagmentation</b><b>-based library preparation protocols</b></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label1' => 'Characteristics',
			'info1' => '<p>The <b>24 UDI (Unique dual indexes) for </b><b>tagmented</b><b> libraries &ndash; Set I </b>is compatible with any <b>tagmentation</b><b>-based library preparation </b>protocols, such as <strong>ChIPmentation</strong>, <b>ATAC-seq</b> or <b>CUT&amp;Tag</b> technologies.</p>
<p>The <b>24 UDI for </b><b>tagmented</b><b> libraries </b>provides combinations of barcodes where each barcode is uniquely attributed to one sample. This is a great tool to identify mistakes during index sequencing. A phenomenon, known as index hopping, can lead to misattribution of some reads to the wrong sample. This is particularly frequent with the NovaSeq6000, and thus the use of Unique Dual Indexing (UDI) is highly recommended when using this sequencer.</p>
<p></p>
<center><img src="https://www.diagenode.com/img/product/kits/UDI-for-tagmented-fig1.png" /></center>
<p></p>
<p><small><strong>Figure 1. Sequencing profiles of &micro;ChIPmentation libraries generated with 24 UDI for Tagmented libraries</strong> Chromatin preparation and immunoprecipitation have been performed on 10.000 cells using the &micro;ChIPmentation Kit for Histones (Cat. No. C01011011) and 24 UDI for Tagmented libraries &ndash; Set I (Cat. No. Cat. No. C01011034) using K562 cells. The Diagenode antibodies targeting H3K4me3 (Cat. No. C15410003) and rabbit IgG (Cat. No. C15410206) have been used. </small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => '',
			'info2' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '24 UDI',
			'catalog_number' => 'C01011034',
			'old_catalog_number' => '',
			'sf_code' => 'C01011034-',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '165',
			'price_USD' => '185',
			'price_GBP' => '155',
			'price_JPY' => '25845',
			'price_CNY' => '',
			'price_AUD' => '462',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => '24-unique-dual-indexes-for-tagmented-libraries-set1',
			'meta_title' => '24 unique dual indexes for tagmented libraries set 1',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2024-05-15 10:25:12',
			'created' => '2020-12-08 15:26:23',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		),
		(int) 2 => array(
			'id' => '3194',
			'antibody_id' => null,
			'name' => 'ATAC-seq kit',
			'description' => '<p><a href="https://www.diagenode.com/files/products/kits/atacseq-kit-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p><strong>ATAC-seq</strong>, Assay for<span>&nbsp;</span><strong>T</strong>ransposase-<strong>A</strong>ccessible<span>&nbsp;</span><strong>C</strong>hromatin, followed by next generation sequencing, is a key technology for genome-wide mapping of accessible chromatin. The technology is based on the use of the<span>&nbsp;</span><strong>transposase Tn5</strong><span>&nbsp;</span>which cuts exposed open chromatin and simultaneously ligates adapters for subsequent amplification and sequencing. ATAC-seq methods allow you to:</p>
<ul>
<li>&nbsp;Gain insight into gene regulation and understand open chromatin signatures</li>
<li>&nbsp;Determine nucleosome positions at single nucleotide resolution</li>
<li>&nbsp;Uncover transcription factor (TF) occupancy</li>
</ul>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Diagenode&rsquo;s<span>&nbsp;</span><b>ATAC-</b><b>seq</b><b><span>&nbsp;</span>kit<span>&nbsp;</span></b>is based on a highly validated protocol optimized for<span>&nbsp;</span><b>50,000<span>&nbsp;</span></b><b>cells</b><b><span>&nbsp;</span>per<span>&nbsp;</span></b><b>reaction</b>. The kit includes the reagents for cell lysis and nuclei extraction, tagmentation and DNA purification as well as for library amplification. The <a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">primer indexes for multiplexing</a> are not included in the kit and must be purchased separately.</p>
<h4><span style="font-weight: 400;">ATAC-seq kit features:</span></h4>
<ul>
<li><b>Cell<span>&nbsp;</span></b><b>requirement</b><b>:<span>&nbsp;</span></b><b>50,000<span>&nbsp;</span></b><b>cells /<span>&nbsp;</span></b><b>rxn</b></li>
<li><b>Robust protocol<span>&nbsp;</span></b>with<span>&nbsp;</span><b>high reproducibility<span>&nbsp;</span></b>between replicates and repetitive experiments</li>
<li><strong>Easy</strong><span>&nbsp;</span>and<span>&nbsp;</span><b>efficient DNA capture<span>&nbsp;</span></b>after the tagmentation reaction using Diagenode`s MicroChIP DiaPure columns (included)</li>
<li>Additional qPCR step to determine the number of cycles needed for library amplification: &nbsp;</li>
<ul type="&rdquo;square&rdquo;">
<li><b>Avoids<span>&nbsp;</span></b><b>over-amplification</b></li>
<li>Allows adaptation/flexibility for<span>&nbsp;</span><b>more challenging samples<span>&nbsp;</span></b>to succeed with library prep.</li>
<li>Gives<span>&nbsp;</span><strong>early indication</strong><span>&nbsp;</span>if the experiment does not work (no qPCR amplification)</li>
</ul>
</ul>
<p>Looking for ATAC-seq on tissue? Please, go to: <a href="https://www.diagenode.com/en/p/ATAC-seq-package-tissue-C01080006">ATAC-seq package for tissue</a></p>',
			'label1' => 'Method overview',
			'info1' => '<p><strong>ATAC-seq</strong>, <strong>A</strong>ssay for <strong>T</strong>ransposase-<strong>A</strong>ccessible <strong>C</strong>hromatin, followed by next generation sequencing, is a key technology to easily identify the <strong>open regions of the chromatin.</strong> The protocol consists of <strong>3 steps</strong>: <strong>nuclei preparation</strong>, <strong>tagmentation</strong> and <strong>library amplification</strong>. First, the cells undergo the lysis, ending with the crude nuclei. Then, the nuclei are incubated with a tagmentase (Tn5 transposase), which &nbsp;cuts the genomic regions associated with open chromatin and inserts the sequencing adaptors. Finally, the generated libraries are amplified and can be used for sequencing. High-throughput sequencing will then detect peaks, in open regions of the chromatin only, giving a map of the chromatin status in the whole genome of the sample.</p>
<p><img src="https://www.diagenode.com/img/product/kits/workflow-atac-seq.png" alt="ATAC-seq kit workflow" width="600px" caption="false" /></p>',
			'label2' => 'Example of results',
			'info2' => '<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig1.png" alt="library prepared with the Diagenode ATAC-seq kit " width="500px" caption="false" /></p>
<p><strong>Figure 1.</strong>Representative Bioanalyzer profile of an ATAC-seq library prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells.</p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig2.png" alt="Diagenode ATAC-seq kit " caption="false" width="951" height="148" /></p>
<p><strong>Figure 2.</strong> Main ATAC-seq alignment and peak calling statistics of 3 replicates prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells. (Mapping efficiency: Percentage of non-mitochondrial reads that mapped to the reference genome. Uniquely mapped ratio: Proportion of mapped reads that map to only one location on the reference genome (hg19). Peaks: Number of peaks (open chromatin regions) identified by MACS2 for each sample. FRiP - Fraction of reads in peaks: Percentage of reads in peaks, with respect to the number of uniquely mapped reads. Sequencing was realized in paired-end mode 50 base pairs (PE50) on an Illumina NovaSeq6000.)</p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig3a.png" alt="Assay for Transposase-Accessible Chromatin" width="500px" caption="false" /></p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig3b.png" alt="Assay for Transposase-Accessible Chromatin" width="500px" caption="false" /></p>
<p><strong>Figure 3</strong> Sequencing profiles of ATAC-seq library (3 replicates) prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells.</p>
<p><img src="https://www.diagenode.com/img/product/kits/atacseq-fig4.png" alt=" open chromatin regions" caption="false" width="383" height="739" /></p>
<p><strong>Figure 4. </strong><br /> Heatmap around TSS of three ATAC-seq replicates prepared with the Diagenode ATAC-seq kit and 24 UDI for tagmented libraries (Cat. No. C01011034) on 50,000 nuclei from K562 cells.</p>',
			'label3' => 'Additional solutions for ATAC-seq kit',
			'info3' => '<p><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes for tagmented libraries</a></p>
<p>Magnetic rack:<span>&nbsp;</span><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag</a><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit"><span>&nbsp;</span>0.2 ml &ndash; Cat. No. B04000001</a></p>
<p>Additional supplies (included in the kit and available separately):</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30"><span>&nbsp;</span>(Tn5 transposase)<span>&nbsp;</span></a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">loaded</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">, Cat. No. C01070012</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation</a><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x"><span>&nbsp;</span>Buffer (2x), Cat. No. C01019043</a></li>
<li><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">MicroChIP</a><span>&nbsp;</span><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">DiaPure</a><span>&nbsp;</span><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">columns</a><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">, Cat. No. C03040001</a></li>
</ul>',
			'format' => '24 rxns',
			'catalog_number' => 'C01080002',
			'old_catalog_number' => '',
			'sf_code' => 'C01080002-',
			'type' => 'RFR',
			'search_order' => '',
			'price_EUR' => '1740',
			'price_USD' => '1745',
			'price_GBP' => '1485',
			'price_JPY' => '272570',
			'price_CNY' => '',
			'price_AUD' => '4362',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'atac-seq-kit-24rxns',
			'meta_title' => 'ATAC-seq kit for open chromatin assessment C01080001 | Diagenode ',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode’s ATAC-seq kit provides a robust protocol for assessing genome-wide chromatin accessibility',
			'modified' => '2024-10-21 10:11:12',
			'created' => '2021-07-01 15:46:58',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		),
		(int) 3 => array(
			'id' => '3215',
			'antibody_id' => null,
			'name' => 'ATAC-seq package for tissue',
			'description' => '<p><a href="https://www.diagenode.com/files/products/kits/atacseq-kit-manual.pdf"><img src="https://www.diagenode.com/img/buttons/bt-manual.png" /></a></p>
<p><b>ATAC-seq</b>, Assay for&nbsp;<b>T</b>ransposase-<b>A</b>ccessible&nbsp;<b>C</b>hromatin, followed by next generation sequencing, is a key technology for genome-wide mapping of accessible chromatin. The technology is based on the use of the&nbsp;<b>transposase Tn5</b>&nbsp;which cuts exposed open chromatin and simultaneously ligates adapters for subsequent amplification and sequencing.</p>
<p>The Diagenode&rsquo;s <b>ATAC-</b><b>seq</b><b> package for tissue </b>has been specifically developted and optimized to generate the ATAC-seq libraries from tissue samples on <b>25 to 100 mg of tissue per </b><b>reaction</b>. The protocol has been validated on many different mammalian tissues (lung, liver, brain, kidney, muscles) and different species (pork, chicken, rat, mice, horse). The package includes the reagents for complete ATAC-seq workflow, including nuclei extraction, library preparation and multiplexing.</p>
<p><strong>Content of the ATAC-seq package for tissues:</strong></p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004" target="_blank" title="Tissue Nuclei Extraction for ATAC-seq">Tissue<span>&nbsp;</span>Nuclei<span>&nbsp;</span>Extraction for ATAC-seq</a><span>&nbsp;</span>&ndash; optimized protocol and reagents for highly efficient nuclei isolation from tissue, preserving the nuclei</li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq<span>&nbsp;</span>kit</a><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns"><span>&nbsp;</span></a>&ndash; generation of high quality libraries</li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24&nbsp;UDI for<span>&nbsp;</span>tagmented<span>&nbsp;</span>libraries*</a><a href="https://www.diagenode.com/en/p/8-unique-dual-indexes-for-tagmented-libraries"><span>&nbsp;</span></a>&ndash; efficient multiplexing allowing for index hopping identification and filtering.&nbsp;</li>
</ul>
<p><strong>Features:</strong></p>
<ul>
<li>Complete solution for the ATAC-seq workflow</li>
<li>Highly efficient nuclei extraction from tissue</li>
<li>Validated on many mammalian tissues</li>
<li>Compatible with Illumina sequencing platforms</li>
</ul>
<p>Looking for ATAC-seq for cells? Please go to<span>&nbsp;</span><a href="https://www.diagenode.com/en/p/atac-seq-kit-8rxns">ATAC-seq kit</a>.</p>
<p><em>* For libraries multiplexing, the ATAC-seq package 24 rxns includes&nbsp; the 24 UDI for tagmented libraries kit - set I, Cat. No. C01011034. If needed, higher multiplexing is possible using other sets of <a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries" target="_blank" title="Primer indexes for tagmented libraries">Primer indexes for tagmented libraries</a>, available separately.</em></p>
<p></p>
<p><small><img src="https://icons.iconarchive.com/icons/wikipedia/flags/256/EU-European-Union-Flag-icon.png" alt="" width="45" />&nbsp; The project GENE-SWitCH leading to this application has received funding from the European Union&rsquo;s Horizon 2020 research and innovation programme under the grant agreement No 817998.<small></small></small></p>',
			'label1' => 'Method overview',
			'info1' => '<p><b>ATAC-seq</b>, <b>A</b>ssay for <b>T</b>ransposase-<b>A</b>ccessible <b>C</b>hromatin, followed by next generation sequencing, is a key technology to easily identify the <b>open regions of the chromatin.</b> The protocol consists of <b>3 steps</b>: <b>nuclei preparation</b>, <b>tagmentation</b> and <b>library amplification</b>. First, the tissue undergoes lysis, ending with the crude nuclei. Then, the nuclei are incubated with a tagmentase (Tn5 transposase), which cuts the genomic regions associated with open chromatin and inserts the sequencing adaptors. Finally, the generated libraries are amplified and can be used for sequencing. High-throughput sequencing will then detect peaks, in open regions of the chromatin only, giving a map of the chromatin status in the whole genome of the sample.</p>
<p><br /> <img src="https://www.diagenode.com/img/product/kits/workflow-atac-seq-tissue.png" alt="workflow" style="display: block; margin-left: auto; margin-right: auto;" width="600px" /></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label2' => 'Example of results',
			'info2' => '<p>GENE-SWitCH aims to deliver new underpinning knowledge on the functional genomes of two main monogastric farm species (pig and chicken) and to enable immediate translation to the pig and poultry sectors. It is a multi-actor project that will produce new genome information to enable the characterization of genetic and epigenetic determinants of complex traits in these two species. Diagenode, as a principal participant to the project and leading the WP1, developed a new protocol to improve the preparation of ATAC-seq libraries from a variety of snap-frozen tissues. The ATAC-seq protocol combines efficient nuclei extraction procedure validated on 7 different kinds of tissues from 3 developmental stages of the two species and a robust Tagmentation protocol based on Diagenode Tn5 enzyme. The developed ATAC-seq protocol was successfully used to produce 168 ATAC-seq libraries for WP1 and 320 for WP5.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/table1-atacseq-results.png" width="400" /></center>
<p><small><strong>Table 1.</strong> List of validated tissues with Diagenode&rsquo;s ATAC-seq package for tissue (Cat. No. C01080005/6). The samples were used as part of GENE-SWitCH consortium.</small></p>
<p>A.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2a-atacseq-results.png" width="700" /></center>
<p>B.</p>
<center><img src="https://www.diagenode.com/img/product/kits/atacseq/fig2b-atacseq-results.png" width="700" /></center>
<p><small><strong>Figure 2.</strong> ATAC-seq library profiles generated using the ATAC-seq package for tissue (Cat. No. C01080005/6) from pork&rsquo;s liver (A) and brain (B). The samples were used as part of GENE-SWitCH consortium.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => 'Additional solutions for ATAC-seq for tissue',
			'info3' => '<p>Additional supplies (included in the kit and available separately):</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">&nbsp;(Tn5 transposase)&nbsp;loaded, Cat. No. C01070012</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation</a><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">&nbsp;Buffer (2x), Cat. No. C01019043</a></li>
<li><a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">MicroChIP</a>&nbsp;<a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">DiaPure</a>&nbsp;<a href="https://www.diagenode.com/en/p/microchip-diapure-columns-50-rxns">columns, Cat. No. C03040001</a></li>
<li><a href="https://www.diagenode.com/en/p/tissue-nuclei-extraction-ATAC-seq-C01080004">Tissue Nuclei Extraction for ATAC-seq, Cat. No. C0108004</a></li>
<li><a href="https://www.diagenode.com/en/p/atac-seq-kit-24rxns">ATAC-seq kit, Cat. No. C01080002</a></li>
</ul>
<p>Other supplies:</p>
<ul>
<li><a href="https://www.diagenode.com/en/categories/primer-indexes-for-tagmented-libraries">Primer indexes for tagmented libraries</a></li>
<li><a href="https://www.diagenode.com/en/p/protease-inhibitor-mix-100-ul">Protease Inhibitor Mix 200X</a></li>
<li>Magnetic rack:&nbsp;<a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">DiaMag</a><a href="https://www.diagenode.com/en/p/diamag02-magnetic-rack-1-unit">&nbsp;0.2 ml &ndash; Cat. No. B04000001</a></li>
</ul>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '24 rxns',
			'catalog_number' => 'C01080006',
			'old_catalog_number' => '',
			'sf_code' => 'C01080006-',
			'type' => 'RFR',
			'search_order' => '',
			'price_EUR' => '2050',
			'price_USD' => '2050',
			'price_GBP' => '1765',
			'price_JPY' => '321130',
			'price_CNY' => '',
			'price_AUD' => '5125',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'ATAC-seq-package-tissue-C01080006',
			'meta_title' => 'ATAC-seq package for tissue|Diagenode C01080006',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode’s ATAC-seq package for tissue provides a robust protocol for assessing genome-wide chromatin accessibility on tissue samples. ',
			'modified' => '2023-04-06 11:06:44',
			'created' => '2022-03-23 16:37:31',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array([maximum depth reached])
		),
		(int) 4 => array(
			'id' => '3057',
			'antibody_id' => null,
			'name' => 'Tagmentase (Tn5 transposase) - unloaded',
			'description' => '<div class="extra-spaced"><center><img alt="Tagmentase (Tn5 transposase)" src="https://www.diagenode.com/img/banners/banner-tagmentase.jpg" caption="false" width="787" height="236" /></center></div>
<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode Tagmentase is a hyperactive Tn5 transposase with the potential to enhance epigenetic studies. Its ability to cut DNA and insert sequences of interest in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq, ChIPmentation, CHANGE-seq and other. The enzyme is not loaded with DNA oligos, providing flexibility of application. To ensure optimal results the concentration may be adjusted with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> (Cat. No. C01070011), available separately.</p>
<p><a href="https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf" target="_blank">Protocol for transposome assembly</a></p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) you may also need:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for loaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) - loaded</a>.</p>',
			'label1' => 'Quality control',
			'info1' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><img alt="Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1a.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="653" height="282" /></p>
<p><img alt="Tagmentase Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1b.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="645" height="278" /></p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 1: Efficient fragmentation of the lambda DNA after incubation with the Tagmentase</strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with diluted Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). Profiles show the size of lambda DNA before (A) and after treatment with Tagmentase (B).</p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns"><center><img alt="Tn5 transposase perfect for NGS" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure2.jpg" width="754" height="492" /></center></div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 2: Fragmentation efficiency depending on the amount of Tagmentase </strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The Tagmentase was previously diluted with the Tagmentase Dilution Buffer (Cat. No.) at &frac14; and 1/16 dilutions. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). The migration of the samples shows variations of the size distribution according to the amount of Tagmentase used for the reaction.</p>
</div>
</div>',
			'label2' => 'Product information',
			'info2' => '<p><strong>Tagmentase (Tn5 transposase) - unloaded</strong></p>
<div><span style="font-family: inherit;">Protein Molecular weight: 53.3 kDa</span></div>
<p>Expressed: in Escherichia coli</p>
<p><strong>Product description:</strong> Diagenode Tagmentase &ndash; unloaded is a hyperactive Tn5 transposase. The enzyme catalyzes &ldquo;cut and paste&rdquo; tagmentation reaction and can be used to insert any target DNA in vitro.</p>
<p><strong>Storage conditions:</strong> Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer: </strong>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>The enzyme should be loaded with appropriate oligonucleotides prior to use. An efficient transposition require that insert DNA have a specific 19-bp transposase recognition sequence (Mosaic End or ME sequence) at each of its ends. The transposome assembly protocol can be found at https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications: </strong>Tagmentase (Tn5 transposase) &ndash; unloaded can be used in a variety of applications including transgenic experiments, barcoding and library construction for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'label3' => '',
			'info3' => '<p></p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
			'format' => '10 µl',
			'catalog_number' => 'C01070010-10',
			'old_catalog_number' => '',
			'sf_code' => 'C01070010-19650',
			'type' => 'FRE',
			'search_order' => '',
			'price_EUR' => '355',
			'price_USD' => '355',
			'price_GBP' => '320',
			'price_JPY' => '55610',
			'price_CNY' => '0',
			'price_AUD' => '888',
			'country' => 'ALL',
			'except_countries' => 'None',
			'quote' => false,
			'in_stock' => false,
			'featured' => false,
			'no_promo' => false,
			'online' => true,
			'master' => true,
			'last_datasheet_update' => '',
			'slug' => 'tagmentase',
			'meta_title' => 'Tagmentase (Tn5 transposase) -unloaded | Diagenode',
			'meta_keywords' => '',
			'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. The enzyme is not loaded with DNA oligos, providing flexibility of application.',
			'modified' => '2024-09-13 15:48:15',
			'created' => '2020-03-24 17:33:04',
			'ProductsRelated' => array(
				[maximum depth reached]
			),
			'Image' => array(
				[maximum depth reached]
			)
		)
	),
	'Application' => array(),
	'Category' => array(
		(int) 0 => array(
			'id' => '3',
			'position' => '4',
			'parent_id' => null,
			'name' => 'Kits',
			'description' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p style="text-align: justify;">Diagenode&rsquo;s epigenetic reagents include:</p>
<ul>
<li style="text-align: justify;"><strong>DNA methylation kits and antibodies</strong> - Validated&nbsp;NGS-compatible kits for MeDIP, MBD pull-down, whole genome bisulfite sequencing, and reduced representation bisulfite sequencing. Official provider for the original clone for 5-mC 33D3.</li>
<li style="text-align: justify;"><strong>ChIP and ChIP-seq kits for industry-leading specificity and sensitivity</strong> - MicroChIP/MicroPlex Kit for ChIP-seq with only 10,000 cells and the iDeal ChIP-seq Kits optimized for both transcription factors and histones. Our kits feature full reagents for ChIP-seq including control primers, control antibodies, magnetics beads, and purification reagents.</li>
<li style="text-align: justify;"><strong>Library preparation kits</strong> tailored for your specific requirements. The MicroPlex Library Preparation Kit simplifies library preparation requiring only 3 simple steps and allowing inputs of only 50 pg.&nbsp;</li>
</ul>
</div>
</div>',
			'no_promo' => false,
			'in_menu' => false,
			'online' => true,
			'tabular' => false,
			'hide' => false,
			'all_format' => false,
			'is_antibody' => false,
			'slug' => 'kits',
			'cookies_tag_id' => null,
			'meta_keywords' => 'DNA methylation Kits,ChIP and ChIP-seq kits,Library preparation kits,MicroChIP/MicroPlex Kit,iDeal Library Preparation Kit',
			'meta_description' => 'Diagenode provides Isotype controls for Methylated DNA Immunoprecipitation',
			'meta_title' => 'Isotype controls for Methylated DNA Immunoprecipitation | Diagenode',
			'modified' => '2019-07-03 10:48:00',
			'created' => '2014-11-13 22:28:36',
			'ProductsCategory' => array(
				[maximum depth reached]
			),
			'CookiesTag' => array([maximum depth reached])
		)
	),
	'Document' => array(
		(int) 0 => array(
			'id' => '1116',
			'name' => 'Datasheet Tagmentase loaded C01070012',
			'description' => '',
			'image_id' => null,
			'type' => 'Datasheet',
			'url' => 'files/products/kits/Datasheet_Tagmentase_loaded_C01070012.pdf',
			'slug' => 'tagmentase-loaded-30-datasheet',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2020-12-10 17:04:06',
			'created' => '2020-12-10 17:04:06',
			'ProductsDocument' => array(
				[maximum depth reached]
			)
		)
	),
	'Feature' => array(),
	'Image' => array(
		(int) 0 => array(
			'id' => '1829',
			'name' => 'https://www.diagenode.com/img/product/kits/tag-loaded.png',
			'alt' => 'Tubes',
			'modified' => '2024-03-28 17:30:39',
			'created' => '2024-03-28 17:30:39',
			'ProductsImage' => array(
				[maximum depth reached]
			)
		)
	),
	'Promotion' => array(),
	'Protocol' => array(),
	'Publication' => array(
		(int) 0 => array(
			'id' => '5002',
			'name' => 'HIRA protects telomeres against R-loop-induced instability in ALT cancer cells',
			'authors' => 'Michelle Lee Lynskey et al.',
			'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HIRA establishes greater telomeric chromatin accessibility after ATRX-DAXX loss</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">Deposition of new H3.3 by HIRA-UBN restricts telomeric ssDNA and TERRA R-loops</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">Unresolved TERRA R-loops block new H3.3 deposition by HIRA-UBN</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">CHK1 phosphorylation of H3.3 is critical to prevent ssDNA and TERRA R-loop buildup</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">Inactivating mutations in chromatin modifiers, like the &alpha;-thalassemia/mental retardation, X-linked (ATRX)-death domain-associated protein (DAXX) chromatin remodeling/histone H3.3 deposition complex, drive the cancer-specific alternative lengthening of telomeres (ALT) pathway. Prior studies revealed that HIRA, another histone H3.3 chaperone, compensates for ATRX-DAXX loss at telomeres to sustain ALT cancer cell survival. How HIRA rescues telomeres from the consequences of ATRX-DAXX deficiency remains unclear. Here, using an assay for transposase-accessible chromatin using sequencing (ATAC-seq) and cleavage under targets and release using nuclease (CUT&amp;RUN), we establish that HIRA-mediated deposition of new H3.3 maintains telomeric chromatin accessibility to prevent the detrimental accumulation of nucleosome-free single-stranded DNA (ssDNA) in ATRX-DAXX-deficient ALT cells. We show that the HIRA-UBN1/UBN2 complex deposits new H3.3 to prevent TERRA R-loop buildup and transcription-replication conflicts (TRCs) at telomeres. Furthermore, HIRA-mediated H3.3 incorporation into telomeric chromatin links productive ALT to the phosphorylation of serine 31, an H3.3-specific amino acid, by Chk1. Therefore, we identify a critical role for HIRA-mediated H3.3 deposition that ensures the survival of ATRX-DAXX-deficient ALT cancer cells.</div>
</section>
<section id="graphical-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name"></h2>
</section>',
			'date' => '2024-11-26',
			'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01315-9',
			'doi' => '10.1016/j.celrep.2024.114964',
			'modified' => '2024-11-12 09:41:40',
			'created' => '2024-11-12 09:41:40',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 1 => array(
			'id' => '4996',
			'name' => 'ARMC5 selectively degrades SCAP-free SREBF1 and is essential for fatty acid desaturation in adipocytes',
			'authors' => 'Akifumi Uota et al.',
			'description' => '<p><span>SREBF1 plays the central role in lipid metabolism. It has been known that full-length SREBF1 that did not associate with SCAP (SCAP-free SREBF1) is actively degraded, but its molecular mechanism and its biological meaning remain unclear. ARMC5-CUL3 complex was recently identified as E3 ubiquitin ligase of full-length SREBF. Although ARMC5 was involved in SREBF pathway in adrenocortical cells, the role of ARMC5 in adipocytes has not been investigated. In this study, adipocyte-specific&nbsp;</span><em>Armc5</em><span><span>&nbsp;</span>knockout mice were generated. In the white adipose tissue (WAT) of these mice, all the stearoyl-CoA desaturase (</span><em>Scd</em><span>) were drastically downregulated. Consistently, unsaturated fatty acids were decreased and saturated fatty acids were increased. The protein amount of full-length SREBF1 were increased, but ATAC-Seq peaks at the SREBF1-binding sites were markedly diminished around the<span>&nbsp;</span></span><em>Scd1</em><span><span>&nbsp;</span>locus in the WAT of<span>&nbsp;</span></span><em>Armc5</em><span><span>&nbsp;</span>knockout mice. Armc5-deficient 3T3-L1 adipocytes also exhibited downregulation of<span>&nbsp;</span></span><em>Scd</em><span>. Mechanistically, disruption of<span>&nbsp;</span></span><em>Armc5</em><span><span>&nbsp;</span>restored decreased full-length SREBF1 in CHO cells deficient for<span>&nbsp;</span></span><em>Scap</em><span>. Overexpression of<span>&nbsp;</span></span><em>Scap</em><span><span>&nbsp;</span>inhibited ARMC5-mediated degradation of full-length SREBF1, and overexpression of<span>&nbsp;</span></span><em>Armc5</em><span><span>&nbsp;</span>increased nuclear SREBF1/full-length SREBF1 ratio and SREBF1 transcriptional activity in the presence of exogenous SCAP. These results demonstrated that ARMC5 selectively removes SCAP-free SREBF1 and stimulates SCAP-mediated SREBF1 processing, hence is essential for fatty acid desaturation<span>&nbsp;</span></span><em>in vivo</em><span>.</span></p>',
			'date' => '2024-11-02',
			'pmid' => 'https://www.sciencedirect.com/science/article/pii/S0021925824024554',
			'doi' => 'https://doi.org/10.1016/j.jbc.2024.107953',
			'modified' => '2024-11-05 08:33:28',
			'created' => '2024-11-05 08:33:28',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 2 => array(
			'id' => '4985',
			'name' => 'HNF1β bookmarking involves Topoisomerase 1 activation and DNA topology relaxation in mitotic chromatin',
			'authors' => 'Alessia Bagattin et al.',
			'description' => '<section id="author-highlights-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Highlights</h2>
<div id="abspara0020" role="paragraph">
<div id="ulist0010" role="list">
<div id="u0010" role="listitem">
<div class="content">
<div id="p0010" role="paragraph">HNF1&beta; mitotic site binding is preserved with a specific methanol/formaldehyde ChIP</div>
</div>
</div>
<div id="u0015" role="listitem">
<div class="content">
<div id="p0015" role="paragraph">BTBD2, an HNF1&beta; partner, mediates mitosis-specific interaction with TOP1</div>
</div>
</div>
<div id="u0020" role="listitem">
<div class="content">
<div id="p0020" role="paragraph">HNF1&beta; recruits TOP1 and induces DNA relaxation around bookmarked HNF1&beta; sites</div>
</div>
</div>
<div id="u0025" role="listitem">
<div class="content">
<div id="p0025" role="paragraph">An HNF1&beta; mutation, found in MODY patients, disrupts the interaction with TOP1</div>
</div>
</div>
</div>
</div>
</section>
<section id="author-abstract" property="abstract" typeof="Text" role="doc-abstract">
<h2 property="name">Summary</h2>
<div id="abspara0010" role="paragraph">HNF1&beta; (<i>HNF1B</i>) is a transcription factor frequently mutated in patients with developmental renal disease. It binds to mitotic chromatin and reactivates gene expression after mitosis, a phenomenon referred to as bookmarking. Using a crosslinking method that circumvents the artifacts of formaldehyde, we demonstrate that&nbsp;HNF1&beta; remains associated with chromatin in a sequence-specific way in both interphase and mitosis. We identify an HNF1&beta;-interacting protein, BTBD2, that enables the interaction and activation of Topoisomerase 1 (TOP1) exclusively during mitosis. Our study identifies a shared microhomology domain between HNF1&beta; and TOP1, where a mutation, found in &ldquo;maturity onset diabetes of the young&rdquo; patients, disrupts their interaction. Importantly, HNF1&beta; recruits TOP1 and induces DNA relaxation around HNF1&beta; mitotic chromatin sites, elucidating its crucial role in chromatin remodeling and gene reactivation after mitotic exit. These findings shed light on how HNF1&beta; reactivates target gene expression after mitosis, providing insights into its crucial role in maintenance of cellular identity.</div>
</section>',
			'date' => '2024-10-08',
			'pmid' => 'https://www.cell.com/cell-reports/fulltext/S2211-1247(24)01156-2',
			'doi' => '10.1016/j.celrep.2024.114805',
			'modified' => '2024-10-14 09:04:44',
			'created' => '2024-10-14 09:04:44',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 3 => array(
			'id' => '4969',
			'name' => 'Nuclear lamin A/C phosphorylation by loss of androgen receptor leads to cancer-associated fibroblast activation',
			'authors' => 'Ghosh S. et al.',
			'description' => '<p><span>Alterations in nuclear structure and function are hallmarks of cancer cells. Little is known about these changes in Cancer-Associated Fibroblasts (CAFs), crucial components of the&nbsp;tumor microenvironment. Loss of the androgen receptor (AR) in human dermal fibroblasts (HDFs), which triggers early steps of CAF activation, leads to nuclear membrane changes and micronuclei formation, independent of cellular senescence. Similar changes occur in established CAFs and are reversed by restoring AR activity. AR associates with nuclear lamin A/C, and its loss causes lamin A/C nucleoplasmic redistribution. AR serves as a bridge between lamin A/C and the protein phosphatase PPP1. Loss of AR decreases lamin-PPP1 association and increases lamin A/C phosphorylation at Ser 301, a characteristic of CAFs. Phosphorylated lamin A/C at Ser 301 binds to the regulatory region of CAF effector genes of the myofibroblast subtype. Expression of a lamin A/C Ser301 phosphomimetic mutant alone can transform normal fibroblasts into tumor-promoting CAFs.</span></p>',
			'date' => '2024-09-12',
			'pmid' => 'https://www.nature.com/articles/s41467-024-52344-z',
			'doi' => 'https://doi.org/10.1038/s41467-024-52344-z',
			'modified' => '2024-09-16 09:43:31',
			'created' => '2024-09-16 09:43:31',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 4 => array(
			'id' => '4970',
			'name' => 'A critical role for HNF4α in polymicrobial sepsis-associated metabolic reprogramming and death',
			'authors' => 'van Dender C. et al. ',
			'description' => '<p><span>In sepsis, limited food intake and increased energy expenditure induce a starvation response, which is compromised by a quick decline in the expression of hepatic PPAR&alpha;, a transcription factor essential in intracellular catabolism of free fatty acids. The mechanism upstream of this PPAR&alpha; downregulation is unknown. We found that sepsis causes a progressive hepatic loss-of-function of HNF4&alpha;, which has a strong impact on the expression of several important nuclear receptors, including PPAR&alpha;. HNF4&alpha; depletion in hepatocytes dramatically increases sepsis lethality, steatosis, and organ damage and prevents an adequate response to IL6, which is critical for liver regeneration and survival. An HNF4&alpha; agonist protects against sepsis at all levels, irrespectively of bacterial loads, suggesting HNF4&alpha; is crucial in tolerance to sepsis. In conclusion, hepatic HNF4&alpha; activity is decreased during sepsis, causing PPAR&alpha; downregulation, metabolic problems, and a disturbed IL6-mediated acute phase response. The findings provide new insights and therapeutic options in sepsis.</span></p>',
			'date' => '2024-09-11',
			'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/39261648/',
			'doi' => '10.1038/s44321-024-00130-1',
			'modified' => '2024-09-16 09:49:27',
			'created' => '2024-09-16 09:49:27',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 5 => array(
			'id' => '4926',
			'name' => 'High-throughput sequencing of insect specimens with sub-optimal DNA preservation using a practical, plate-based Illumina-compatible Tn5 transposase library preparation method',
			'authors' => 'Cobb L. et all.',
			'description' => '<p><span>Entomological sampling and storage conditions often prioritise efficiency, practicality and conservation of morphological characteristics, and may therefore be suboptimal for DNA preservation. This practice can impact downstream molecular applications, such as the generation of high-throughput genomic libraries, which often requires substantial DNA input amounts. Here, we use a practical Tn5 transposase tagmentation-based library preparation method optimised for 96-well plates and low yield DNA extracts from insect legs that were stored under sub-optimal conditions for DNA preservation. The samples were kept in field vehicles for extended periods of time, before long-term storage in ethanol in the freezer, or dry at room temperature. By reducing DNA input to 6ng, more samples with sub-optimal DNA yields could be processed. We matched this low DNA input with a 6-fold dilution of a commercially available tagmentation enzyme, significantly reducing library preparation costs. Costs and workload were further suppressed by direct post-amplification pooling of individual libraries. We generated medium coverage (&gt;3-fold) genomes for 88 out of 90 specimens, with an average of approximately 10-fold coverage. While samples stored in ethanol yielded significantly less DNA compared to those which were stored dry, these samples had superior sequencing statistics, with longer sequencing reads and higher rates of endogenous DNA. Furthermore, we find that the efficiency of tagmentation-based library preparation can be improved by a thorough post-amplification bead clean-up which selects against both short and large DNA fragments. By opening opportunities for the use of sub-optimally preserved, low yield DNA extracts, we broaden the scope of whole genome studies of insect specimens. We therefore expect these results and this protocol to be valuable for a range of applications in the field of entomology.</span></p>',
			'date' => '2024-03-22',
			'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38517905/',
			'doi' => '10.1371/journal.pone.0300865',
			'modified' => '2024-03-25 11:15:06',
			'created' => '2024-03-25 11:15:06',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 6 => array(
			'id' => '4923',
			'name' => 'On the identification of differentially-active transcription factors from ATAC-seq data',
			'authors' => 'Gerbaldo F. et al.',
			'description' => '<p><span>ATAC-seq has emerged as a rich epigenome profiling technique, and is commonly used to identify Transcription Factors (TFs) underlying given phenomena. A number of methods can be used to identify differentially-active TFs through the accessibility of their DNA-binding motif, however little is known on the best approaches for doing so. Here we benchmark several such methods using a combination of curated datasets with various forms of short-term perturbations on known TFs, as well as semi-simulations. We include both methods specifically designed for this type of data as well as some that can be repurposed for it. We also investigate variations to these methods, and identify three particularly promising approaches (chromVAR-limma with critical adjustments, monaLisa and a combination of GC smooth quantile normalization and multivariate modeling). We further investigate the specific use of nucleosome-free fragments, the combination of top methods, and the impact of technical variation. Finally, we illustrate the use of the top methods on a novel dataset to characterize the impact on DNA accessibility of TRAnscription Factor TArgeting Chimeras (TRAFTAC), which can deplete TFs &ndash; in our case NFkB &ndash; at the protein level.</span></p>',
			'date' => '2024-03-10',
			'pmid' => 'https://www.biorxiv.org/content/10.1101/2024.03.06.583825v2',
			'doi' => 'https://doi.org/10.1101/2024.03.06.583825',
			'modified' => '2024-03-13 17:04:33',
			'created' => '2024-03-13 17:04:33',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 7 => array(
			'id' => '4918',
			'name' => 'Cellular reprogramming in vivo initiated by SOX4 pioneer factor activity',
			'authors' => 'Katsuda T.',
			'description' => '<p><span>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate &ldquo;reprogramming&rdquo; by opening new chromatin sites for expression that can attract transcription factors from the starting cell&rsquo;s enhancers. Here we report that SOX4 is sufficient to initiate hepatobiliary metaplasia in the adult mouse liver, closely mimicking metaplasia initiated by toxic damage to the liver. In lineage-traced cells, we assessed the timing of SOX4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, SOX4 directly binds to and closes hepatocyte regulatory sequences via an overlapping motif with HNF4A, a hepatocyte master regulatory transcription factor. Subsequently, SOX4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</span></p>',
			'date' => '2024-02-26',
			'pmid' => 'https://www.nature.com/articles/s41467-024-45939-z',
			'doi' => 'https://doi.org/10.1038/s41467-024-45939-z',
			'modified' => '2024-02-29 11:59:10',
			'created' => '2024-02-29 11:59:10',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 8 => array(
			'id' => '4889',
			'name' => 'The ncBAF complex regulates transcription in AML through H3K27ac sensing by BRD9',
			'authors' => 'Klein D.C. et al. ',
			'description' => '<p><span>The non-canonical BAF complex (ncBAF) subunit BRD9 is essential for acute myeloid leukemia (AML) cell viability but has an unclear role in leukemogenesis. Because BRD9 is required for ncBAF complex assembly through its DUF3512 domain, precise bromodomain inhibition is necessary to parse the role of BRD9 as a transcriptional regulator from that of a scaffolding protein. To understand the role of BRD9 bromodomain function in regulating AML, we selected a panel of five AML cell lines with distinct driver mutations, disease classifications, and genomic aberrations and subjected these cells to short-term BRD9 bromodomain inhibition. We examined the bromodomain-dependent growth of these cell lines, identifying a dependency in AML cell lines but not HEK293T cells. To define a mechanism through which BRD9 maintains AML cell survival, we examined nascent transcription, chromatin accessibility, and ncBAF complex binding genome-wide after bromodomain inhibition. We identified extensive regulation of transcription by BRD9 bromodomain activity, including repression of myeloid maturation factors and tumor suppressor genes, while standard AML chemotherapy targets were repressed by inhibition of the BRD9 bromodomain. BRD9 bromodomain activity maintained accessible chromatin at both gene promoters and gene-distal putative enhancer regions, in a manner that qualitatively correlated with enrichment of BRD9 binding. Furthermore, we identified reduced chromatin accessibility at GATA, ETS, and AP-1 motifs and increased chromatin accessibility at SNAIL-, HIC-, and TP53-recognized motifs after BRD9 inhibition. These data suggest a role for BRD9 in regulating AML cell differentiation through modulation of accessibility at hematopoietic transcription factor binding sites.</span></p>',
			'date' => '2023-12-21',
			'pmid' => 'https://pubmed.ncbi.nlm.nih.gov/38126767/',
			'doi' => '10.1158/2767-9764.CRC-23-0382',
			'modified' => '2024-01-02 11:07:14',
			'created' => '2024-01-02 11:07:14',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 9 => array(
			'id' => '4878',
			'name' => 'ARID1A governs the silencing of sex-linked transcription during male meiosis in the mouse',
			'authors' => 'Menon D.U. et al.',
			'description' => '<p><span>We present evidence implicating the BAF (BRG1/BRM Associated Factor) chromatin remodeler in meiotic sex chromosome inactivation (MSCI). By immunofluorescence (IF), the putative BAF DNA binding subunit, ARID1A (AT-rich Interaction Domain 1a), appeared enriched on the male sex chromosomes during diplonema of meiosis I. The germ cell-specific depletion of ARID1A resulted in a pachynema arrest and failure to repress sex-linked genes, indicating a defective MSCI. Consistent with this defect, mutant sex chromosomes displayed an abnormal presence of elongating RNA polymerase II coupled with an overall increase in chromatin accessibility detectable by ATAC-seq. By investigating potential mechanisms underlying these anomalies, we identified a role for ARID1A in promoting the preferential enrichment of the histone variant, H3.3, on the sex chromosomes, a known hallmark of MSCI. Without ARID1A, the sex chromosomes appeared depleted of H3.3 at levels resembling autosomes. Higher resolution analyses by CUT&amp;RUN revealed shifts in sex-linked H3.3 associations from discrete intergenic sites and broader gene-body domains to promoters in response to the loss of ARID1A. Several sex-linked sites displayed ectopic H3.3 occupancy that did not co-localize with DMC1 (DNA Meiotic Recombinase 1). This observation suggests a requirement for ARID1A in DMC1 localization to the asynapsed sex chromatids. We conclude that ARID1A-directed H3.3 localization influences meiotic sex chromosome gene regulation and DNA repair.</span></p>',
			'date' => '2023-09-28',
			'pmid' => 'https://www.biorxiv.org/content/10.1101/2023.05.25.542290v2.abstract',
			'doi' => 'https://doi.org/10.1101/2023.05.25.542290',
			'modified' => '2023-11-10 14:53:09',
			'created' => '2023-11-10 14:53:09',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 10 => array(
			'id' => '4825',
			'name' => 'Zfp296 knockout enhances chromatin accessibility and induces a uniquestate of pluripotency in embryonic stem cells.',
			'authors' => 'Miyazaki  S. et al.',
			'description' => '<p>The Zfp296 gene encodes a zinc finger-type protein. Its expression is high in mouse embryonic stem cells (ESCs) but rapidly decreases following differentiation. Zfp296-knockout (KO) ESCs grew as flat colonies, which were reverted to rounded colonies by exogenous expression of Zfp296. KO ESCs could not form teratomas when transplanted into mice but could efficiently contribute to germline-competent chimeric mice following blastocyst injection. Transcriptome analysis revealed that Zfp296 deficiency up- and down-regulates a distinct group of genes, among which Dppa3, Otx2, and Pou3f1 were markedly downregulated. Chromatin immunoprecipitation sequencing demonstrated that ZFP296 binding is predominantly seen in the vicinity of the transcription start sites (TSSs) of a number of genes, and ZFP296 was suggested to negatively regulate transcription. Consistently, chromatin accessibility assay clearly showed that ZFP296 binding reduces the accessibility of the TSS regions of target genes. Zfp296-KO ESCs showed increased histone H3K9 di- and trimethylation. Co-immunoprecipitation analyses revealed interaction of ZFP296 with G9a and GLP. These results show that ZFP296 plays essential roles in maintaining the global epigenetic state of ESCs through multiple mechanisms including activation of Dppa3, attenuation of chromatin accessibility, and repression of H3K9 methylation, but that Zfp296-KO ESCs retain a unique state of pluripotency while lacking the teratoma-forming ability.</p>',
			'date' => '2023-07-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37488353',
			'doi' => '10.1038/s42003-023-05148-8',
			'modified' => '2023-08-01 13:30:58',
			'created' => '2023-08-01 15:59:38',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 11 => array(
			'id' => '4817',
			'name' => 'YAP/BRD4-controlled ROR1 promotes tumor-initiating cells andhyperproliferation in pancreatic cancer.',
			'authors' => 'Yamazaki  M. et al.',
			'description' => '<p><span>Tumor-initiating cells are major drivers of chemoresistance and attractive targets for cancer therapy, however, their identity in human pancreatic ductal adenocarcinoma (PDAC) and the key molecules underlying their traits remain poorly understood. Here, we show that a cellular subpopulation with partial epithelial-mesenchymal transition (EMT)-like signature marked by high expression of receptor tyrosine kinase-like orphan receptor 1 (ROR1) is the origin of heterogeneous tumor cells in PDAC. We demonstrate that ROR1 depletion suppresses tumor growth, recurrence after chemotherapy, and metastasis. Mechanistically, ROR1 induces the expression of Aurora kinase B (AURKB) by activating E2F through c-Myc to enhance PDAC proliferation. Furthermore, epigenomic analyses reveal that ROR1 is transcriptionally dependent on YAP/BRD4 binding at the enhancer region, and targeting this pathway reduces ROR1 expression and prevents PDAC growth. Collectively, our findings reveal a critical role for ROR1high cells as tumor-initiating cells and the functional importance of ROR1 in PDAC progression, thereby highlighting its therapeutic targetability.</span></p>',
			'date' => '2023-04-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37096681',
			'doi' => '10.15252/embj.2022112614',
			'modified' => '2023-06-15 10:06:12',
			'created' => '2023-06-13 21:11:31',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 12 => array(
			'id' => '4757',
			'name' => 'Analyzing genomic and epigenetic profiles in single cells by hybridtransposase (scGET-seq).',
			'authors' => 'Cittaro  D. et al.',
			'description' => '<p>scGET-seq simultaneously profiles euchromatin and heterochromatin. scGET-seq exploits the concurrent action of transposase Tn5 and its hybrid form TnH, which targets H3K9me3 domains. Here we present a step-by-step protocol to profile single cells by scGET-seq using a 10&Atilde;&mdash; Chromium Controller. We describe steps for transposomes preparation and validation. We detail nuclei preparation and transposition, followed by encapsulation, library preparation, sequencing, and data analysis. For complete details on the use and execution of this protocol, please refer to Tedesco et&Acirc;&nbsp;al. (2022) and de Pretis and Cittaro (2022)..</p>',
			'date' => '2023-03-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/37000619',
			'doi' => '10.1016/j.xpro.2023.102176',
			'modified' => '2023-04-17 09:04:55',
			'created' => '2023-04-14 13:41:22',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 13 => array(
			'id' => '4742',
			'name' => 'A neurodevelopmental epigenetic programme mediated bySMARCD3-DAB1-Reelin signalling is hijacked to promote medulloblastomametastasis.',
			'authors' => 'Zou  Han et al.',
			'description' => '<p>How abnormal neurodevelopment relates to the tumour aggressiveness of medulloblastoma (MB), the most common type of embryonal tumour, remains elusive. Here we uncover a neurodevelopmental epigenomic programme that is hijacked to induce MB metastatic dissemination. Unsupervised analyses of integrated publicly available datasets with our newly generated data reveal that SMARCD3 (also known as BAF60C) regulates Disabled&acirc;&euro;&permil;1 (DAB1)-mediated Reelin signalling in Purkinje cell migration and MB metastasis by orchestrating cis-regulatory elements at the DAB1 locus. We further identify that a core set of transcription factors, enhancer of zeste homologue&acirc;&euro;&permil;2 (EZH2) and nuclear factor&acirc;&euro;&permil;I&acirc;&euro;&permil;X (NFIX), coordinates with the cis-regulatory elements at the SMARCD3 locus to form a chromatin hub to control SMARCD3 expression in the developing cerebellum and in metastatic MB. Increased SMARCD3 expression activates Reelin-DAB1-mediated Src kinase signalling, which results in a MB response to Src inhibition. These data deepen our understanding of how neurodevelopmental programming influences disease progression and provide a potential therapeutic option for patients with MB.</p>',
			'date' => '2023-02-01',
			'pmid' => 'https://www.ncbi.nlm.nih.gov/pubmed/36849558',
			'doi' => '10.1038/s41556-023-01093-0',
			'modified' => '2023-03-14 09:41:24',
			'created' => '2023-03-02 17:27:08',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 14 => array(
			'id' => '4568',
			'name' => 'Physiological reprogramming in vivo mediated by Sox4 pioneer factoractivity',
			'authors' => 'Katsuda  T. et al.',
			'description' => '<p>Tissue damage elicits cell fate switching through a process called metaplasia, but how the starting cell fate is silenced and the new cell fate is activated has not been investigated in animals. In cell culture, pioneer transcription factors mediate &ldquo;reprogramming&rdquo; by opening new chromatin sites for expression that can attract transcription factors from the starting cell&rsquo;s enhancers. Here we report that Sox4 is sufficient to initiate hepatobiliary metaplasia in the adult liver. In lineage-traced cells, we assessed the timing of Sox4-mediated opening of enhancer chromatin versus enhancer decommissioning. Initially, Sox4 directly binds to and closes hepatocyte regulatory sequences via a motif it overlaps with Hnf4a, a hepatocyte master regulator. Subsequently, Sox4 exerts pioneer factor activity to open biliary regulatory sequences. The results delineate a hierarchy by which gene networks become reprogrammed under physiological conditions, providing deeper insight into the basis for cell fate transitions in animals.</p>',
			'date' => '2023-01-01',
			'pmid' => 'https://doi.org/10.1101%2F2023.02.14.528556',
			'doi' => '10.1101/2023.02.14.528556',
			'modified' => '2023-04-11 10:26:02',
			'created' => '2023-02-21 09:59:46',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		),
		(int) 15 => array(
			'id' => '4660',
			'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
			'authors' => 'Zolotarev  Nikolay et al.',
			'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to na&iuml;ve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
			'date' => '2022-11-01',
			'pmid' => 'https://doi.org/10.1073%2Fpnas',
			'doi' => '10.1073/pnas.2210595119',
			'modified' => '2023-03-07 09:07:41',
			'created' => '2023-02-21 09:59:46',
			'ProductsPublication' => array(
				[maximum depth reached]
			)
		)
	),
	'Testimonial' => array(
		(int) 0 => array(
			'id' => '82',
			'name' => 'Tagmentase',
			'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
			'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
			'featured' => true,
			'slug' => 'testimonial-tagmentase',
			'meta_keywords' => '',
			'meta_description' => '',
			'modified' => '2023-02-08 09:40:13',
			'created' => '2023-02-08 09:37:00',
			'ProductsTestimonial' => array(
				[maximum depth reached]
			)
		)
	),
	'Area' => array(),
	'SafetySheet' => array(
		(int) 0 => array(
			'id' => '2128',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS US en',
			'language' => 'en',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-US-en-GHS_1_0.pdf',
			'countries' => 'US',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 1 => array(
			'id' => '2126',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS GB en',
			'language' => 'en',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-GB-en-GHS_1_0.pdf',
			'countries' => 'GB',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 2 => array(
			'id' => '2121',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS BE fr',
			'language' => 'fr',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-BE-fr-GHS_1_0.pdf',
			'countries' => 'BE',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 3 => array(
			'id' => '2125',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS FR fr',
			'language' => 'fr',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-FR-fr-GHS_1_0.pdf',
			'countries' => 'FR',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 4 => array(
			'id' => '2124',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS ES es',
			'language' => 'es',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-ES-es-GHS_1_0.pdf',
			'countries' => 'ES',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 5 => array(
			'id' => '2123',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS DE de',
			'language' => 'de',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-DE-de-GHS_1_0.pdf',
			'countries' => 'DE',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 6 => array(
			'id' => '2127',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS JP ja',
			'language' => 'ja',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-JP-ja-GHS_2_0.pdf',
			'countries' => 'JP',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		),
		(int) 7 => array(
			'id' => '2122',
			'name' => 'Tagmentase (Tn5 transposase) - loaded SDS BE nl',
			'language' => 'nl',
			'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-BE-nl-GHS_1_0.pdf',
			'countries' => 'BE',
			'modified' => '2021-10-12 14:34:34',
			'created' => '2021-10-12 14:34:34',
			'ProductsSafetySheet' => array(
				[maximum depth reached]
			)
		)
	)
)
$meta_canonical = 'https://www.diagenode.com/cn/p/tagmentase-loaded-30'
$country = 'US'
$countries_allowed = array(
	(int) 0 => 'CA',
	(int) 1 => 'US',
	(int) 2 => 'IE',
	(int) 3 => 'GB',
	(int) 4 => 'DK',
	(int) 5 => 'NO',
	(int) 6 => 'SE',
	(int) 7 => 'FI',
	(int) 8 => 'NL',
	(int) 9 => 'BE',
	(int) 10 => 'LU',
	(int) 11 => 'FR',
	(int) 12 => 'DE',
	(int) 13 => 'CH',
	(int) 14 => 'AT',
	(int) 15 => 'ES',
	(int) 16 => 'IT',
	(int) 17 => 'PT'
)
$outsource = true
$other_formats = array(
	(int) 0 => array(
		'id' => '3164',
		'antibody_id' => null,
		'name' => 'Tagmentase (Tn5 transposase) - loaded',
		'description' => '<div class="row">
<div class="small-12 medium-8 large-8 columns">
<p>&nbsp;</p>
<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
		'label1' => 'Examples of results',
		'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label2' => 'Product information',
		'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span> 3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span> 3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span> correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions: </strong>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong> Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong> Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div>ATAC-seq package for tissue, Cat. No.&nbsp;<span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label3' => '',
		'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'format' => '30 μl',
		'catalog_number' => 'C01070012-30',
		'old_catalog_number' => '',
		'sf_code' => 'C01070012-143301',
		'type' => 'FRE',
		'search_order' => '',
		'price_EUR' => '330',
		'price_USD' => '330',
		'price_GBP' => '300',
		'price_JPY' => '51695',
		'price_CNY' => '',
		'price_AUD' => '825',
		'country' => 'ALL',
		'except_countries' => 'None',
		'quote' => false,
		'in_stock' => false,
		'featured' => true,
		'no_promo' => false,
		'online' => true,
		'master' => true,
		'last_datasheet_update' => '',
		'slug' => 'tagmentase-loaded-30',
		'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 30 | Diagenode',
		'meta_keywords' => '',
		'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
		'modified' => '2024-09-13 15:36:59',
		'created' => '2020-12-08 16:15:40'
	),
	(int) 1 => array(
		'id' => '3205',
		'antibody_id' => null,
		'name' => 'Tagmentase (Tn5 transposase) - loaded',
		'description' => '<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
		'label1' => 'Examples of results',
		'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label2' => 'Product information',
		'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span><span>&nbsp;</span>3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span><span>&nbsp;</span>correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions:</strong><span>&nbsp;</span>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong><span>&nbsp;</span>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage:&nbsp;</strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong><span>&nbsp;</span>Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div><span>ATAC-seq package for tissue, Cat. No.&nbsp;</span><span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'label3' => '',
		'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
		'format' => '200 μl',
		'catalog_number' => 'C01070012-200',
		'old_catalog_number' => '',
		'sf_code' => 'C01070012-93190',
		'type' => 'FRE',
		'search_order' => '',
		'price_EUR' => '2090',
		'price_USD' => '2090',
		'price_GBP' => '1800',
		'price_JPY' => '327400',
		'price_CNY' => '0',
		'price_AUD' => '5225',
		'country' => 'ALL',
		'except_countries' => 'None',
		'quote' => true,
		'in_stock' => false,
		'featured' => false,
		'no_promo' => false,
		'online' => true,
		'master' => false,
		'last_datasheet_update' => '',
		'slug' => 'tagmentase-loaded-200',
		'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Diagenode',
		'meta_keywords' => '',
		'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
		'modified' => '2024-09-13 15:37:53',
		'created' => '2021-10-21 11:35:59',
		'ProductsGroup' => array(
			'id' => '400',
			'product_id' => '3205',
			'group_id' => '331'
		)
	)
)
$pro = array(
	'id' => '3205',
	'antibody_id' => null,
	'name' => 'Tagmentase (Tn5 transposase) - loaded',
	'description' => '<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
	'label1' => 'Examples of results',
	'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label2' => 'Product information',
	'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span><span>&nbsp;</span>3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span><span>&nbsp;</span>correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions:</strong><span>&nbsp;</span>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong><span>&nbsp;</span>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage:&nbsp;</strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong><span>&nbsp;</span>Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div><span>ATAC-seq package for tissue, Cat. No.&nbsp;</span><span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label3' => '',
	'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'format' => '200 μl',
	'catalog_number' => 'C01070012-200',
	'old_catalog_number' => '',
	'sf_code' => 'C01070012-93190',
	'type' => 'FRE',
	'search_order' => '',
	'price_EUR' => '2090',
	'price_USD' => '2090',
	'price_GBP' => '1800',
	'price_JPY' => '327400',
	'price_CNY' => '0',
	'price_AUD' => '5225',
	'country' => 'ALL',
	'except_countries' => 'None',
	'quote' => true,
	'in_stock' => false,
	'featured' => false,
	'no_promo' => false,
	'online' => true,
	'master' => false,
	'last_datasheet_update' => '',
	'slug' => 'tagmentase-loaded-200',
	'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Diagenode',
	'meta_keywords' => '',
	'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
	'modified' => '2024-09-13 15:37:53',
	'created' => '2021-10-21 11:35:59',
	'ProductsGroup' => array(
		'id' => '400',
		'product_id' => '3205',
		'group_id' => '331'
	)
)
$edit = ''
$testimonials = ''
$featured_testimonials = '<blockquote><span class="label-green" style="margin-bottom:16px;margin-left:-22px">TESTIMONIAL</span><p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p><cite>Julia Liz Touza, AstraZeneca Gothenburg, Sweden</cite></blockquote>
'
$testimonial = array(
	'id' => '82',
	'name' => 'Tagmentase',
	'description' => '<p><span>We have been using the Hyperactive Tagmentase for 2 years and its performance is outstanding - short operation time and good reproducibility, outmatching the competition. Moreover the interaction with customer representatives is always top-notch - highly efficient and knowledgeable. I can't recommend enough!</span></p>',
	'author' => 'Julia Liz Touza, AstraZeneca Gothenburg, Sweden',
	'featured' => true,
	'slug' => 'testimonial-tagmentase',
	'meta_keywords' => '',
	'meta_description' => '',
	'modified' => '2023-02-08 09:40:13',
	'created' => '2023-02-08 09:37:00',
	'ProductsTestimonial' => array(
		'id' => '200',
		'product_id' => '3165',
		'testimonial_id' => '82'
	)
)
$related_products = '<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/tagmentation-buffer-2x"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01019043</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3162" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3162" id="CartAdd/3162Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3162" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> Tagmentation Buffer (2x)</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
                    'C01019043',
                     '100',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentation Buffer (2x)',
                    'C01019043',
                    '100',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="tagmentation-buffer-2x" data-reveal-id="cartModal-3162" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">Tagmentation Buffer (2x)</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/24-unique-dual-indexes-for-tagmented-libraries-set1"><img src="/img/product/kits/kit-icon.png" alt="Kit icon" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01011034</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3158" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3158" id="CartAdd/3158Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3158" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> 24 UDI for Tagmented libraries - Set I</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
                    'C01011034',
                     '185',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('24 UDI for Tagmented libraries - Set I',
                    'C01011034',
                    '185',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="24-unique-dual-indexes-for-tagmented-libraries-set1" data-reveal-id="cartModal-3158" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">24 UDI for Tagmented libraries - Set I</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/atac-seq-kit-24rxns"><img src="/img/product/kits/atacseq-kit-picture.jpg" alt="ATAC-seq kit" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01080002</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3194" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3194" id="CartAdd/3194Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3194" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ATAC-seq kit</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq kit',
                    'C01080002',
                     '1745',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq kit',
                    'C01080002',
                    '1745',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="atac-seq-kit-24rxns" data-reveal-id="cartModal-3194" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">ATAC-seq kit</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/ATAC-seq-package-tissue-C01080006"><img src="/img/grey-logo.jpg" alt="default alt" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01080006</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3215" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3215" id="CartAdd/3215Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3215" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> ATAC-seq package for tissue</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
                    'C01080006',
                     '2050',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('ATAC-seq package for tissue',
                    'C01080006',
                    '2050',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="ATAC-seq-package-tissue-C01080006" data-reveal-id="cartModal-3215" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">ATAC-seq package for tissue</h6>
        </div>

    </div>
</li>
<li>
    <div class="row">
        <div class="small-12 columns">
                         <a href="/cn/p/tagmentase"><img src="https://www.diagenode.com/img/product/kits/tag-unloaded.png" alt="Tubes" class="th"/></a>        </div>



        <div class="small-12 columns">
            <div class="small-6 columns" style="padding-left:0px;padding-right:0px;margin-top:-6px;margin-left:-1px">
                <span class="success label" style="">C01070010-10</span>
            </div>
            <div class="small-6 columns text-right" style="padding-left:0px;padding-right:0px;margin-top:-6px">
                <!--a href="#" style="color:#B21329"><i class="fa fa-info-circle"></i></a-->
                <!-- BEGIN: ADD TO CART MODAL --><div id="cartModal-3057" class="reveal-modal small" data-reveal aria-labelledby="modalTitle" aria-hidden="true" role="dialog">
<form action="/cn/carts/add/3057" id="CartAdd/3057Form" method="post" accept-charset="utf-8"><div style="display:none;"><input type="hidden" name="_method" value="POST"/></div><input type="hidden" name="data[Cart][product_id]" value="3057" id="CartProductId"/>
<div class="row">
    <div class="small-12 medium-12 large-12 columns">
        
        <p>将 <input name="data[Cart][quantity]" placeholder="1" value="1" min="1" style="width:60px;display:inline" type="number" id="CartQuantity" required="required"/> <strong> Tagmentase (Tn5 transposase) - unloaded</strong> 添加至我的购物车。</p>

        <div class="row">
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentase (Tn5 transposase) - unloaded',
                    'C01070010-10',
                     '355',
                       $('#CartQuantity').val());" name="checkout" id="checkout" value="checkout" type="submit">结账</button>            </div>
            <div class="small-6 medium-6 large-6 columns">
                <button class="alert small button expand" onclick="$(this).addToCart('Tagmentase (Tn5 transposase) - unloaded',
                    'C01070010-10',
                    '355',
                       $('#CartQuantity').val());" name="keepshop" id="keepshop" type="submit">继续购物</button>            </div>
        </div>
    </div>
</div>

</form><a class="close-reveal-modal" aria-label="Close">&#215;</a></div><!-- END: ADD TO CART MODAL --><a href="#" id="tagmentase" data-reveal-id="cartModal-3057" class="" style="color:#B21329"><i class="fa fa-cart-plus"></i></a>
            </div>

        </div>
        <div class="small-12 columns" >
            <h6 style="height:60px">Tagmentase</h6>
        </div>

    </div>
</li>
'
$related = array(
	'id' => '3057',
	'antibody_id' => null,
	'name' => 'Tagmentase (Tn5 transposase) - unloaded',
	'description' => '<div class="extra-spaced"><center><img alt="Tagmentase (Tn5 transposase)" src="https://www.diagenode.com/img/banners/banner-tagmentase.jpg" caption="false" width="787" height="236" /></center></div>
<div class="row">
<div class="small-12 medium-8 large-8 columns"><br />
<p>Diagenode Tagmentase is a hyperactive Tn5 transposase with the potential to enhance epigenetic studies. Its ability to cut DNA and insert sequences of interest in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq, ChIPmentation, CHANGE-seq and other. The enzyme is not loaded with DNA oligos, providing flexibility of application. To ensure optimal results the concentration may be adjusted with Diagenode <a href="https://www.diagenode.com/en/p/tagmentase-dilution-buffer">Tagmentase Dilution Buffer</a> (Cat. No. C01070011), available separately.</p>
<p><a href="https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf" target="_blank">Protocol for transposome assembly</a></p>
</div>
<div class="small-12 medium-4 large-4 columns"><center>
<script>// <![CDATA[
var date = new Date(); var heure = date.getHours(); var jour = date.getDay(); var semaine = Math.floor(date.getDate() / 7) + 1; if (jour === 2 && ( (heure >= 9 && heure < 9.5) || (heure >= 18 && heure < 18.5) )) { document.write('<a href="https://us02web.zoom.us/j/85467619762"><img src="https://www.diagenode.com/img/epicafe-ON.gif"></a>'); } else { document.write('<a href="https://go.diagenode.com/l/928883/2023-04-26/3kq1v"><img src="https://www.diagenode.com/img/epicafe-OFF.png"></a>'); }
// ]]></script>
</center></div>
</div>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) you may also need:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for loaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) - loaded</a>.</p>',
	'label1' => 'Quality control',
	'info1' => '<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><img alt="Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1a.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="653" height="282" /></p>
<p><img alt="Tagmentase Tn5 transposase" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure-1b.jpg" style="display: block; margin-left: auto; margin-right: auto;" width="645" height="278" /></p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 1: Efficient fragmentation of the lambda DNA after incubation with the Tagmentase</strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with diluted Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). Profiles show the size of lambda DNA before (A) and after treatment with Tagmentase (B).</p>
</div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns"><center><img alt="Tn5 transposase perfect for NGS" src="https://www.diagenode.com/img/product/reagents/tagmentase-figure2.jpg" width="754" height="492" /></center></div>
</div>
<div class="row">
<div class="small-12 medium-12 large-12 columns">
<p><strong>Figure 2: Fragmentation efficiency depending on the amount of Tagmentase </strong><br />For fragmentation, 100 ng of DNA from bacteriophage lambda were incubated with Diagenode Tagmentase (Cat. No. C01070010) and Tagmentation buffer (1x) (Cat. No. C01019042) for 7 min at 55&deg;C. The Tagmentase was previously diluted with the Tagmentase Dilution Buffer (Cat. No.) at &frac14; and 1/16 dilutions. The reaction was stopped by addition of SDS (0.2% final concentration). After clean-up using AMPure XP beads (Beckman Coulter) on Diagenode IP-Star robot, the size of the DNA was assessed on Fragment Analyzer (Agilent), using the HS Large Fragment 50kb Kit (Agilent). The migration of the samples shows variations of the size distribution according to the amount of Tagmentase used for the reaction.</p>
</div>
</div>',
	'label2' => 'Product information',
	'info2' => '<p><strong>Tagmentase (Tn5 transposase) - unloaded</strong></p>
<div><span style="font-family: inherit;">Protein Molecular weight: 53.3 kDa</span></div>
<p>Expressed: in Escherichia coli</p>
<p><strong>Product description:</strong> Diagenode Tagmentase &ndash; unloaded is a hyperactive Tn5 transposase. The enzyme catalyzes &ldquo;cut and paste&rdquo; tagmentation reaction and can be used to insert any target DNA in vitro.</p>
<p><strong>Storage conditions:</strong> Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer: </strong>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage: </strong>The enzyme should be loaded with appropriate oligonucleotides prior to use. An efficient transposition require that insert DNA have a specific 19-bp transposase recognition sequence (Mosaic End or ME sequence) at each of its ends. The transposome assembly protocol can be found at https://www.diagenode.com/files/protocols/PRO-Transposome-Assembly-V2.pdf Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications: </strong>Tagmentase (Tn5 transposase) &ndash; unloaded can be used in a variety of applications including transgenic experiments, barcoding and library construction for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label3' => '',
	'info3' => '<p></p>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script async="" src="https://edge.fullstory.com/s/fs.js" crossorigin="anonymous"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'format' => '10 µl',
	'catalog_number' => 'C01070010-10',
	'old_catalog_number' => '',
	'sf_code' => 'C01070010-19650',
	'type' => 'FRE',
	'search_order' => '',
	'price_EUR' => '355',
	'price_USD' => '355',
	'price_GBP' => '320',
	'price_JPY' => '55610',
	'price_CNY' => '0',
	'price_AUD' => '888',
	'country' => 'ALL',
	'except_countries' => 'None',
	'quote' => false,
	'in_stock' => false,
	'featured' => false,
	'no_promo' => false,
	'online' => true,
	'master' => true,
	'last_datasheet_update' => '',
	'slug' => 'tagmentase',
	'meta_title' => 'Tagmentase (Tn5 transposase) -unloaded | Diagenode',
	'meta_keywords' => '',
	'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. The enzyme is not loaded with DNA oligos, providing flexibility of application.',
	'modified' => '2024-09-13 15:48:15',
	'created' => '2020-03-24 17:33:04',
	'ProductsRelated' => array(
		'id' => '4923',
		'product_id' => '3165',
		'related_id' => '3057'
	),
	'Image' => array(
		(int) 0 => array(
			'id' => '1828',
			'name' => 'https://www.diagenode.com/img/product/kits/tag-unloaded.png',
			'alt' => 'Tubes',
			'modified' => '2024-03-28 17:29:30',
			'created' => '2024-03-28 17:29:30',
			'ProductsImage' => array(
				[maximum depth reached]
			)
		)
	)
)
$rrbs_service = array(
	(int) 0 => (int) 1894,
	(int) 1 => (int) 1895
)
$chipseq_service = array(
	(int) 0 => (int) 2683,
	(int) 1 => (int) 1835,
	(int) 2 => (int) 1836,
	(int) 3 => (int) 2684,
	(int) 4 => (int) 1838,
	(int) 5 => (int) 1839,
	(int) 6 => (int) 1856
)
$labelize = object(Closure) {
	
}
$old_catalog_number = ''
$country_code = 'US'
$other_format = array(
	'id' => '3205',
	'antibody_id' => null,
	'name' => 'Tagmentase (Tn5 transposase) - loaded',
	'description' => '<p>Diagenode <b>Tagmentase</b><b> &ndash; loaded </b>is a <strong>hyperactive Tn5 transposase</strong> preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments using powerful technologies such as ATAC-seq or ChIPmentation.</p>
<p>Using Diagenode&rsquo;s Tagmentase (Tn5 transposase) - loaded you may need also:</p>
<ul>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-1x-1ml">Tagmentation Buffer (1x)</a></li>
<li><a href="https://www.diagenode.com/en/p/tagmentation-buffer-2x">Tagmentation Buffer (2x)</a></li>
<li><a href="https://www.diagenode.com/en/p/24-unique-dual-indexes-for-tagmented-libraries-set1">24 UDI for tagmented libraries</a></li>
</ul>
<p>Looking for unloaded Tagmentase? Please go to <a href="https://www.diagenode.com/en/p/tagmentase-20-ul">Tagmentase</a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul"> (Tn5 transposase) &ndash; </a><a href="https://www.diagenode.com/en/p/tagmentase-20-ul">unloaded</a></p>',
	'label1' => 'Examples of results',
	'info1' => '<p><b>Tagmentase</b><b> (Tn5 transposase) &ndash; </b><b>loaded</b> can be used in any application using tagmentation-based library preparation, like for example ChIPmentation, ATAC-seq.&nbsp; Here below we are showing some examples of results.</p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig1.png" width="700" alt="Tn5 transposase Enxzymes" caption="false" /></center>
<p><small><strong>Figure 1. Typical library profile of ATAC-seq library generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<div class="row">
<div class="small-8 columns">
<div class="small-4 columns"><center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig2.png" width="200" alt="Diagenode Tagmentation " caption="false" /></center></div>
<div class="small-8 columns">
<p><small><strong>Figure 2. Enrichments at TSS of ATAC-seq libraries generated with the Tagmentase</strong><br />ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043). Heatmaps around the hg19 TSS were generated using deeptools plotHeatmap functionality.</small></p>
</div>
</div>
</div>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig3.png" alt="Transposase enzymes for ATAC-Seq" caption="false" width="956" height="259" /></center>
<p><small><strong>Figure 3. Sequencing profiles of ATAC-seq libraries generated with the Tagmentase</strong><br /> ATAC-seq has been performed on 50,000 nuclei from K562 cells, in triplicates, using the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012) and Tagmentation Buffer (2x) (Cat. No. C01019043).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig4.png" width="700" alt="purified Transposase enzymes " caption="false" /></center>
<p><small><strong>Figure 4. Typical library profile of ChIPmentation library generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 1,000,000 K562 cells using the ChIPmentation Kit for Histones (Cat. No. C01011010) in combination with the Diagenode antibody targeting H3K4me3 (Cat. No. C15410003) and with the Tagmentase (Tn5 transposase) &ndash; loaded (Cat. No. C01070012). The library profile has been generated on a Fragment Analyzer (Agilent).</small></p>
<center><img src="https://www.diagenode.com/img/product/kits/tagmentase-loaded-fig5.png" alt="pA-Tn5 Transposase Enzymes" caption="false" width="956" height="262" /></center>
<p><small><strong>Figure 5. Sequencing profiles of ChIPmentation libraries generated with the Tagmentase</strong><br /> Chromatin preparation and immunoprecipitation have been performed on 500.000 to 1,000,000 cells using the <a href="https://www.diagenode.com/en/p/manual-chipmentation-kit-for-histones-24-rxns">ChIPmentation Kit for Histones </a>(Cat. No. C01011010) in combination with the <a href="https://www.diagenode.com/en/p/tagmentase-loaded-30">Tagmentase (Tn5 transposase) &ndash; loaded </a>(Cat. No. C01070012) on K562 cells. The Diagenode antibodies targeting <a href="https://www.diagenode.com/en/p/h3k4me3-polyclonal-antibody-premium-50-ug-50-ul">H3K4me3 </a>(Cat. No. C15410003), <a href="https://www.diagenode.com/en/p/h3k27ac-polyclonal-antibody-premium-50-mg-18-ml">H3K27ac </a>(Cat. No. C15410196), <a href="https://www.diagenode.com/en/p/h3k36me3-polyclonal-antibody-premium-50-mg">H3K36me3 </a>(Cat. No. C15410192), <a href="https://www.diagenode.com/en/p/h3k27me3-polyclonal-antibody-premium-50-mg-27-ml">H3K27me3</a> (Cat. No. C15410195) and rabbit <a href="https://www.diagenode.com/en/p/rabbit-igg-250-ug-250-ul">IgG </a>(Cat. No. C15410206) have been used.</small></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label2' => 'Product information',
	'info2' => '<p><strong>Tagmentase (Tn5 transposase) - loaded&nbsp;</strong></p>
<div>Protein Molecular weight: 53.3 kDa</div>
<p>Expressed: in Escherichia coli</p>
<p></p>
<p><strong>Product description:</strong>&nbsp; Diagenode Tagmentase &ndash; loaded is a hyperactive Tn5 transposase preloaded with Illumina-compatible sequencing adapters. Its ability to cut DNA and insert the sequencing adapters in one step makes it the perfect companion for Next-Generation Sequencing experiments. The Tagmentase is pre-loaded with sequencing adapters compatible with Illumina Nextera platforms, as shown below. The oligos loaded on the Tagmentase are inserted into DNA upon a tagmentation reaction.</p>
<div>Mosaic end_reverse: 5&rsquo; [PHO]<span style="text-decoration: underline;">CTGTCTCTTATACACATCT</span><span>&nbsp;</span>3&rsquo;</div>
<div>Mosaic end_Adapter A: 5&rsquo; TCGTCGGCAGCGTC<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</div>
<p>Mosaic end_Adapter B: 5&rsquo; GTCTCGTGGGCTCGG<span style="text-decoration: underline;">AGATGTGTATAAGAGACAG</span><span>&nbsp;</span>3&rsquo;</p>
<p></p>
<div><span style="text-decoration: underline;">Underlined regions</span><span>&nbsp;</span>correspond to the double-stranded part of the adapter, recognized by the Tagmentase. The final libraries can be amplified using Diagenode Primer indexes for tagmented libraries:</div>
<div>24 SI for tagmented libraries, Cat. No. C01011032</div>
<div>24 UDI fortagmented libraries - Set I, Cat. No. C0101134</div>
<div>24 UDI for tagmented libraries - Set II, Cat. No. C0101136</div>
<p>24 UDI for tagmented libraries - Set III, Cat. No. C0101137</p>
<p></p>
<p><strong>Storage conditions:</strong><span>&nbsp;</span>Store at -20&deg;C. Guaranteed stable for 6 months from date of receipt when stored properly.</p>
<p><strong>Storage buffer:</strong><span>&nbsp;</span>Supplied in solution containing 50% v/v glycerol.</p>
<p><strong>Properties &amp; Usage:&nbsp;</strong>Tagmentase is dependent on Mg++ for activity. Avoid chelators, such as EDTA/EGTA, in reaction buffers. The enzyme is active at pH 7.5-8 at 37-55&deg;C. SDS, EDTA/EGTA or heating to 65&deg;C will inactivate the enzyme.</p>
<p><strong>Applications:</strong><span>&nbsp;</span>Tagmentase (Tn5 transposase) &ndash; loaded can be used in a variety of applications to construct library for second-generation sequencing. Please note that an additional optimization might be required for custom protocols including the enzyme dose- and time-response experiments.</p>
<div>For ATAC-seq and ChIPmentation, we recommend using Diagenode validated protocols:</div>
<div>ATAC-seq kit, Cat. No. C01080002</div>
<div><span>ATAC-seq package for tissue, Cat. No.&nbsp;</span><span>C01080006</span></div>
<div>ChIPmentation Kit for Histones, Cat. No. C01011009</div>
<div>&micro;ChIPmentation Kit for Histones, Cat. No. C01011011</div>
<div>TAG Kit for ChIPmentation, Cat. No. C01011030</div>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'label3' => '',
	'info3' => '<p></p>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>
<script src="chrome-extension://hhojmcideegachlhfgfdhailpfhgknjm/web_accessible_resources/index.js"></script>',
	'format' => '200 μl',
	'catalog_number' => 'C01070012-200',
	'old_catalog_number' => '',
	'sf_code' => 'C01070012-93190',
	'type' => 'FRE',
	'search_order' => '',
	'price_EUR' => '2090',
	'price_USD' => '2090',
	'price_GBP' => '1800',
	'price_JPY' => '327400',
	'price_CNY' => '0',
	'price_AUD' => '5225',
	'country' => 'ALL',
	'except_countries' => 'None',
	'quote' => true,
	'in_stock' => false,
	'featured' => false,
	'no_promo' => false,
	'online' => true,
	'master' => false,
	'last_datasheet_update' => '',
	'slug' => 'tagmentase-loaded-200',
	'meta_title' => 'Tagmentase (Tn5 transposase) - loaded - 200 | Diagenode',
	'meta_keywords' => '',
	'meta_description' => 'Diagenode Tagmentase is a hyperactive Tn5 transposase with the ability to cut DNA and insert sequences of interest into any target DNA in one step. ',
	'modified' => '2024-09-13 15:37:53',
	'created' => '2021-10-21 11:35:59',
	'ProductsGroup' => array(
		'id' => '400',
		'product_id' => '3205',
		'group_id' => '331'
	)
)
$label = '<img src="/img/banners/banner-customizer-back.png" alt=""/>'
$document = array(
	'id' => '1116',
	'name' => 'Datasheet Tagmentase loaded C01070012',
	'description' => '',
	'image_id' => null,
	'type' => 'Datasheet',
	'url' => 'files/products/kits/Datasheet_Tagmentase_loaded_C01070012.pdf',
	'slug' => 'tagmentase-loaded-30-datasheet',
	'meta_keywords' => '',
	'meta_description' => '',
	'modified' => '2020-12-10 17:04:06',
	'created' => '2020-12-10 17:04:06',
	'ProductsDocument' => array(
		'id' => '3059',
		'product_id' => '3165',
		'document_id' => '1116'
	)
)
$sds = array(
	'id' => '2122',
	'name' => 'Tagmentase (Tn5 transposase) - loaded SDS BE nl',
	'language' => 'nl',
	'url' => 'files/SDS/Tagmentase/SDS-C01070012-Tagmentase_Tn5_transposase_-_loaded-BE-nl-GHS_1_0.pdf',
	'countries' => 'BE',
	'modified' => '2021-10-12 14:34:34',
	'created' => '2021-10-12 14:34:34',
	'ProductsSafetySheet' => array(
		'id' => '3675',
		'product_id' => '3165',
		'safety_sheet_id' => '2122'
	)
)
$publication = array(
	'id' => '4660',
	'name' => 'EBF1 is continuously required for stabilizing local chromatinaccessibility in pro-B cells.',
	'authors' => 'Zolotarev  Nikolay et al.',
	'description' => '<p>The establishment of de novo chromatin accessibility in lymphoid progenitors requires the "pioneering" function of transcription factor (TF) early B cell factor 1 (EBF1), which binds to na&iuml;ve chromatin and induces accessibility by recruiting the BRG1 chromatin remodeler subunit. However, it remains unclear whether the function of EBF1 is continuously required for stabilizing local chromatin accessibility. To this end, we replaced EBF1 by EBF1-FKBP in pro-B cells, allowing the rapid degradation by adding the degradation TAG13 (dTAG13) dimerizer. EBF1 degradation results in a loss of genome-wide EBF1 occupancy and EBF1-targeted BRG1 binding. Chromatin accessibility was rapidly diminished at EBF1-binding sites with a preference for sites whose occupancy requires the pioneering activity of the C-terminal domain of EBF1. Diminished chromatin accessibility correlated with altered gene expression. Thus, continuous activity of EBF1 is required for the stable maintenance of the transcriptional and epigenetic state of pro-B cells.</p>',
	'date' => '2022-11-01',
	'pmid' => 'https://doi.org/10.1073%2Fpnas',
	'doi' => '10.1073/pnas.2210595119',
	'modified' => '2023-03-07 09:07:41',
	'created' => '2023-02-21 09:59:46',
	'ProductsPublication' => array(
		'id' => '6552',
		'product_id' => '3165',
		'publication_id' => '4660'
	)
)
$externalLink = ' <a href="https://doi.org/10.1073%2Fpnas" target="_blank"><i class="fa fa-external-link"></i></a>'
include - APP/View/Products/view.ctp, line 755
View::_evaluate() - CORE/Cake/View/View.php, line 971
View::_render() - CORE/Cake/View/View.php, line 933
View::render() - CORE/Cake/View/View.php, line 473
Controller::render() - CORE/Cake/Controller/Controller.php, line 963
ProductsController::slug() - APP/Controller/ProductsController.php, line 1052
ReflectionMethod::invokeArgs() - [internal], line ??
Controller::invokeAction() - CORE/Cake/Controller/Controller.php, line 491
Dispatcher::_invoke() - CORE/Cake/Routing/Dispatcher.php, line 193
Dispatcher::dispatch() - CORE/Cake/Routing/Dispatcher.php, line 167
[main] - APP/webroot/index.php, line 118

Contact Information

First name

Last name

Company

Phone number

City

Country

State

Email verification^*

Comment

活动

查看所有活动

Site map | Contact us | Conditions of sales | Conditions of purchase | Privacy policy

Tagmentase (Tn5 transposase) - loaded SDS US en	Download
Tagmentase (Tn5 transposase) - loaded SDS GB en	Download
Tagmentase (Tn5 transposase) - loaded SDS BE fr	Download
Tagmentase (Tn5 transposase) - loaded SDS FR fr	Download
Tagmentase (Tn5 transposase) - loaded SDS ES es	Download
Tagmentase (Tn5 transposase) - loaded SDS DE de	Download
Tagmentase (Tn5 transposase) - loaded SDS JP ja	Download
Tagmentase (Tn5 transposase) - loaded SDS BE nl	Download