Diagenode

NGS Library preparation

Library preparation for RNA sequencing

D-Plex Small RNA-seq library prep kit with UMI for Illumina

Diagenode technology utilizes the innovative capture and amplification by tailing and switching, a ligation-free method to produce DNA libraries for next generation sequencing from low input RNA. This solution is designed for an advanced researcher who has extensive experience with RNA sequencing. While simple and fast, Diagenode RNA-seq solutions offers a number of advanced features for challenging samples for an expert user.

  • Learn more

    The template-switch protocol is much more efficient for RNA-seq library creation than protocols that use ligase by incorporating sequencing adaptors during cDNA synthesis in a single reaction tube. D-Plex thus allows for optimal sequencing of sensitive, degraded, rare, and low input RNA samples. The CATS and D-Plex RNA-seq kits for library preparation are ideal for studying extracellular cell-free RNA (cfRNA) that may potentially represent cancer biomarkers, and are detected as serum or plasma-derived RNA, FFPE-derived RNA, and exosomal RNAs.

    Additionally, template switch-based RNA sequencing is optimal for the study of non-coding RNA (ncRNA) that regulate gene expression at the transcriptional and post-transcriptional level including miRNA and long non-coding RNA ( lncRNA).

Why the new D-Plex Small RNA benefits RNA research

  • Easy to use with minimal hands-on time: one day, one tube protocol.
  • Unique-in-the world technology combining UMIs with template switching
  • Excellent reproducibility with ultra low RNA inputs down to 10 pg
  • Diverse transcript detection
  • Optimal performance on challenging samples
  • Retaining strand specificity of origin

The simplest, fastest, flexible and most realistic small RNA-seq is here. Read more about D-Plex Small RNA-seq Kit for Illumina.

Very reproducible library preparation method

Transcripts detected in two technical replicates of CATS v2 total RNA-seq libraries. TPM≥2
Input: 1 ng rRNA(-) RNA from human universal total RNA (Agilent, 740000).

See characteristics

Technical note: CATS Small RNA-seq Kit

Low input RNA-seq library preparation provides higher small non-coding RNA diversity and greatly reduced hands-on time

Prior to RNA sequencing, the preparation of suitable libraries for the NGS platform is required . The library preparation typically requires the conversion of the template RNA into cDNA and the fusion of adapters to both ends before PCR amplification. For ligation-based techniques, the addition of the adapters by RNA ligase is heavily biased because of its uneven affinity towards the different template sequences. In addition, these techniques necessitate large amounts of RNA input.

This white paper discusses the straightforward, cost-effective, highly efficient “Capture and Amplification by Tailing and Switching” (CATS) to easily generate ready-to-sequence NGS libraries from picogram quantities of RNA.

Download

Webinar about Capture and Amplification by Tailing and Switching (CATS) solution

Watch here

Jordan Lewandowski, PhD; HSCRB // Harvard
I like the Diagenode CATS RNA-seq kit for a number of reasons….
Read more about CATS mRNA-seq Kit

How to choose your CATS RNA-seq Library Preparation Kit

Small RNAs

(Small non-coding RNA)

Input 10 pg-10 ng

Total RNA

(Whole transcriptome)

Input 100 pg-10 ng

mRNA

(Transcriptome)

Input 100 pg-10 ng

CATS Total RNA-seq Kit v2
(with rRNA depletion module)

CATS RNA-seq Kit v2
(no polyA selection, no rRNA depletion modules)

CATS mRNA-seq Kit v2
(with polyA selection module)

CATS RNA-seq Kit v2
(no polyA selection, no rRNA depletion modules)

Note: Input refers to isolated small RNA, rRNA depleted or poly(A) selected RNA

  • Which Illumina sequencing platform should I use when working with CATS RNA-seq libraries?
    Diagenode recommends whenever possible to sequence CATS RNA-seq libraries on 4-colour Illumina sequencing platforms (e.g. HiSeq 2500 and MiSeq). However, CATS RNA-seq is also compatible with other Illumina sequencing machines, although particular sequencing recommendations are advised as below.

    Sequencing recommendations
    Platform Single end sequencing Paired-end sequencing # % of PhiX to include in the library pool
    MiSeq Illumina standard sequencing primer for read1 Read1: Illumina sequencing primer

    Read2: CATS paired-end sequencing primer (for read2) (C17011050) as stand-alone (*)
    1-5
    HiSeq 2500 Illumina standard sequencing primer for read1 Read1: Illumina sequencing primer

    Read2: CATS paired-end sequencing primer (for read2) (C17011050) as stand-alone (*)
    1-5
    NextSeq 500 Illumina standard sequencing primer for read1 Read1: Illumina sequencing primer

    Read2: CATS paired-end sequencing primer (for read2) (C17011050) as stand-alone (*)
    20
    HiSeq 3000/4000 Illumina standard sequencing primer for read1 Read1: Illumina sequencing primer

    Read2: CATS paired-end sequencing primer (for read2) (C17011050) as stand-alone (*)
    20

    # applies to CATS mRNA-seq, CATS total RNA-seq and CATS RNA-seq Kits
    (*) Read2: Do NOT spike a “custom” CATS paired-end sequencing primer (for read2) (C17011050) into the standard Illumina primer (because the standard primer will lead to sequencing of polyA tracts, reducing run quality).

    PhiX is required and will be read from read1, but will not be read in read2.

    Further information on how to treat custom sequencing primer on Illumina platforms can be found following the links below:

    https://support.illumina.com/downloads/miseq-system-custom-primers-guide-15041638.html
    https://support.illumina.com/downloads/hiseq-using-custom-primers-reference-guide-15061846.html
    https://support.illumina.com/downloads/nextseq-500-custom-primers-guide-15057456.html

  • Which commands should I use when trimming reads prior to mapping of CATS RNA-seq data?
    Due to special construct of CATS libraries including template switching and artificial poly(A) tailing, particular trimming procedures are needed to clean the reads prior to mapping. This step is mandatory -- not completing or improperly completing this step may result in a low mapping rate of the reads.

    Here are the commands that should be used with the Cutadapt software to trim reads (SE, PE) prior to mapping.

    Read1 cutadapt --trim-n -a GATCGGAAGAGCACACGTCTG -a AGAGCACACGTCTG <input.file> | cutadapt -u 3 -a A{100} --no-indels -e 0.16666666666666666 - | cutadapt -O 8 --match-readwildcards -g GTTCAGAGTTCTACAGTCCGACGATCSSS -m 18 -o <output.file> -

    Read2 cutadapt --trim-n --match-read-wildcards -n 2 -g T{100} -a SSSGATCGTCGG -m 18 -o <output.file> <input.file>

    For paired-end reads both commands: Read1 and Read2 are needed. For single reads please use only the Read1 command. Note that an installation of Cutadapt is necessary.
  • How long is the CATS RNA-seq library preparation protocol?
    For the RNA-seq library preparation itself, takes 4h30-5h to complete for a trained user. This does not include the sample preparation (e.g. polyA selection, rRNA depletion or small RNA enrichment) and the QC of the library. Each of those two steps take additional approximate 1h.
  • What is the shelf life of CATS RNA-seq kits?
    2 years.
  • I would like to sequence pooled libraries prepared with the CATS RNA-seq kit and from some other kit vendors. How should I proceed with barcoding?
    CATS RNA-seq kits include up to 24 indexes. CATS uses the TruSeq small RNA indexes. CATS libraries can be sequenced together with other Illumina compatible libraries as long as the indexes do not overlap.
  • If using CATS paired-end sequencing primer for read2, will I also sequence a PhiX control in read2 mode?
    No. PhiX is meant to be sequenced with the standard Illumina sequencing primer. CATS paired-end sequencing primer for read2 will not read the PhiX control.
  • I would like to study some specific RNA molecules that are between 80-300 nt. Which would be a solution for this?
    A size selection of the bulk RNA can be performed before starting the library preparation. This can be easily done with Agencourt AMPure RNAClean XP beads or QIAGEN miRNeasy Mini Kit.
  • Does the CATS RNA-seq library preparation require working on ice?
    No. The library preparation can be carried on a bench at room temperature. However, reagents and RNA solution which are taken out of the freezer must be placed on ice if not used immediately (once thawed). In the same way, reagents and RNA solution that are no longer being used must be quickly stored back in the freezer. Please consult respective manuals for storage conditions.
  • Is there any contamination with adapter dimers in CATS RNA-seq libraries?
    There is no adapter dimer contamination in CATS RNA-seq libraries, since the technology does not use any ligase. There is no step of ligation, thus adapters cannot be ligated to each other. Additionally there is no “empty library” in the CATS RNA-seq technology.
  • I end up with low % of mapped reads after mapping to the reference genome with CATS RNA-seq library prep. What would you advise?
    Before mapping, CATS RNA-seq data requires a specific trimming procedure described in all manuals. Please consult also a user guide “Diagenode trimming tools for CATS RNA-seq” https://www.diagenode.com/files/products/kits/CATS-Trimming-10_17.pdf
  • Have we tested CATS small RNA-seq on plasma or serum samples?
    Yes. CATS technology works on RNA extracted from serum and plasma samples. It works very well for circulating RNAs.
  • Does CATS RNA-seq kit work with standard Illumina sequencing primers?
    Yes. For single-end sequencing we recommend using the regular Illumina sequencing primer (read 1). For paired-end sequencing the “CATS paired-end sequencing primer (for read2)” is required.
  • What is the standard RNA fragments length that can be used in CATS RNA-seq kits?
    For CATS total RNA-seq (with rRNA depletion) Kit, CATS mRNA-seq (with polyA selection) Kit and CATS RNA-seq Kits, we are chemically fragmenting RNA to achieve a mean size between 200-500nt. Please see the image below.

    Regarding the CATS small RNA-seq Kit, you recommend two options: either starting with total RNA (intact) or the small RNA fraction (< 200nt).
  • What is the species compatibility of the CATS RNA-seq kits?
    Kit Compatibility
    Small RNA-seq Kit / CATS RNA-seq Any species (incl. bacteria)
    rRNA depletion module (CATS Total RNA-seq Kit) Human, mouse, rat*
    polyA selection module (CATS mRNA-seq Kit) Need for mRNAs with polyA tail at 3' end (eucaryotes)
    *Not for bacteria and we haven't planned to work on validating other species right now.

Cell-Free Transcriptome

目录号产品格式价格
C05030040 D-Plex cell-free RNA-seq Kit
Full-spectrum extracellular RNA profiling for non-invasive biomarker discoveryCell-free RNA (cfRNA) in biofluids is an exceptionally dynamic and information-...
24 rxns $1,545.00
C05030045 D-Plex UDI for cell-free RNA-seq - Set A
D-Plex UDI for cell-free RNA-seq - Set A includes primer pairs with 24 unique dual barcodes (unique i5 and i7 indexes) for library multiplexing with the D-Pl...
24 rxns $375.00
C05030046 D-Plex UDI for cell-free RNA-seq - Set B
D-Plex UDI for cell-free RNA-seq - Set A includes primer pairs with 24 unique dual barcodes (unique i5 and i7 indexes) for library multiplexing with the D-Pl...
24 rxns $375.00

Illumina sequencing platform

目录号产品格式价格
C05030001 D-Plex Small RNA-seq Kit x24 for Illumina
Download the manual Diagenode’s latest innovation in RNA-seq, D-Plex, is based on a template-switching technology that delivers a ...
24 rxns $1,530.00
C05030021 D-Plex Unique Dual Indexes for Illumina - Set A
D-Plex Unique Dual Indexes Module - Set A includes PCR primers with 24 unique dual barcodes (unique i5 and i7 indexes) for library multiplexin...
24 rxns $375.00
C05030022 D-Plex Unique Dual Indexes for Illumina - Set B
(Comming soon)D-Plex Unique Dual Indexes Module - Set B includes PCR primers with 24 unique dual barcodes (unique i5 and i7 indexes) for libra...
24 rxns $375.00
C05030023 D-Plex Unique Dual Indexes for Illumina - Set C
D-Plex Unique Dual Indexes Module - Set A includes primer pairs with 24 unique dual barcodes (unique i5 and i7 indexes) for library multiplexi...
24 rxns $375.00
C05030024 D-Plex Unique Dual Indexes for Illumina - Set D
D-Plex Unique Dual Indexes Module - Set A includes primer pairs with 24 unique dual barcodes (unique i5 and i7 indexes) for library multiplexi...
24 rxns $375.00

MGI sequencing platform

目录号产品格式价格
C05030060 D-Plex 24 DNBSEQ Barcodes - Set A
D-Plex DNBSEQ Barcodes should be used with the D-Plex Small RNA DNBSEQTM Kit. They were designed and validated to fit the D-Plex technology for MGI® sequ...
24 rxns $360.00
C05030061 D-Plex 24 DNBSEQ Barcodes - Set B
D-Plex DNBSEQ Barcodes should be used with the D-Plex Small RNA DNBSEQTM Kit. They were designed and validated to fit the D-Plex technology for MGI®...
24 rxns $360.00
C05030051 D-Plex Small RNA DNBSEQ™ Kit
D-Plex Small RNA DNBSEQ™ Kit is a tool designed for the study of the small non-coding transcriptome. The kit is using the D-Plex technology to generate...
24 rxns $1,555.00